Transcript asmbl_11077

Sequence
Transcript Sequence for observation asmbl_11077 of TGE0000076:
TTGGACATTTCTTAACAGCAGGGCCACCAGGCAGAGCGGGACAGCCAGGAGGAAGGGCAGCTTGGCAGAGCCTCAGGATGGACCCCCTTGGGGACACGCTGCGGCGACTGCGGGAGGCCTTCCACGCGGGGCGCACGCGGCCAGCTGAGTTCCGGGCTGCGCAGCTCCAAGGCCTGGGCCGCTTCCTGCAAGAAAACAAGCAGCTTCTGCACGACGCACTGGCCCAGGACCTGCACAAGTCAGCCTTCGAGTCGGAGGTGTCTGAGGTTGCCATCAGCCAGGGCGAGGTCACCCTGGCCCTCAGGAACCTCCGGGCCTGGATGAAGGACGAGCGTGTGCCCAAGAACCTGGCCACGCAGCTGGACTCCGCCTTCATCCGGAAGGAGCCCTTTGGCCTGGTCCTCATCATTGCGCCCTGGAACTATCCGCTGAACCTGACGCTGGTGCCCCTCGTGGGAGCCCTCGCTGCAGGGAACTGTGTGGTGCTGAAGCCATCGGAGATTAGCAAGAACGTCGAGAAGATCCTGGCCGAGGTGCTGCCCCAATACGTGGACCAGAGCTGCTTTGCTGTGGTGCTGGGCGGGCCCCAGGAGACGGGGCAGCTGCTAGAGCACAGGTTCGACTACATCTTCTTCACAGGGAGCCCTCGTGTGGGCAAGATTGTTATGACTGCTGCCGCCAAGCACCTGACACCTGTCACCCTGGAGCTGGGGGGCAAGAACCCTTGCTACGTGGACGACAACTGCGACCCCCAGACCGTGGCCAACCGCGTGGCCTGGTTCCGCTACTTCAACGCCGGCCAGACCTGCGTGGCCCCCGACTACGTCCTATGCAGCCCTGAGATGCAGGAGAGGCTGCTGCCTGCCCTGCAGAGCACCATCACCCGTTTCTATGGCGACGACCCCCAGAGCTCCCCAAACCTGGGCCGCATCATCAACCAGAAACAGTTCCAGCGGCTGCGGGCATTGCTGGGCTGCGGCCGTGTGGCCATTGGGGGCCAGAGCGATGAGAGCGATCGCTACATCGCCCCCACGGTGCTGGTGGATGTGCAGGAGATGGAGCCTGTGATGCAGGAGGAGATCTTCGGGCCCATCCTGCCCATCGTGAACGTGCAGAGCTTGGACGAGGCCATCGAGTTCATCAACCGGCGGGAGAAGCCCCTGGCCCTGTACGCCTTCTCCAACAGCAGCCAGGTGGTCAAGCGGGTGCTGACCCAGACCAGCAGCGGGGGCTTCTGTGGGAACGACGGCTTCATGCACATGACCCTGGCCAGCCTGCCTTTTGGAGGAGTGGGTGCCAGTGGGATGGGCCGGTACCATGGCAAGTTCTCCTTCGACACCTTCTCCCACCATCGCGCCTGCCTCCTGCGCAGCCCGGGGATGGAGAAGCTCAACGCCCTCCGCTACCCGCCG