Transcript asmbl_71588

Sequence
Transcript Sequence for observation asmbl_71588 of TGE0007479:
CCTCCAGCTGCAGAGCCCCAGTTTGTCTTTTTTTTTTAAACTAAAATGGAGGCTGGTTTCTCGCCTTAAGGAGCCCATTGCCTTCCCCGCCGAGCCTAGATGTTGACATGTAATAAAGCGGGCAGCAGGATGGTGGTGGATGCGGCCAGCTCCAACGGGCCTTTCCAGCCCGTGGCGCTTCTCCATATTCGAGATGTTCCTCCTGCCGATCAAGAGAAGCTTTTTATCCAGAAGTTACGTCAGTGTTGTGTCCTCTTTGACTTTGTTTCCGACCCACTAAGTGACCTAAAGTGGAAGGAAGTAAAACGAGCTGCTTTAAGTGAGATGGTAGAATACATCACCCATAATCGGAATGTGATCACAGAGCCGATTTACCCGGAAGTAGTCCACATGTTTGCAGTTAACATGTTTCGCACGTTACCGCCTTCCTCCAACCCTACGGGAGCAGAGTTTGACCCAGAGGAAGACGAGCCAACGTTAGAAGCCGCCTGGCCTCACCTGCAGCTTGTTTATGAATTTTTCTTAAGATTTTTAGAGTCTCCAGATTTCCAACCTAATATAGCGAAGAAATATATTGATCAGAAGTTTGTATTGCAGCTTTTAGAGCTCTTCGACAGCGAAGATCCTCGGGAGAGAGATTTTCTTAAAACTACCCTTCACAGAATCTATGGAAAATTCTTAGGCTTAAGAGCTTACATCAGAAAACAGATAAATAATATATTTTATAGGTTTATTTATGAAACAGAGCATCACAATGGCATAGCAGAGTTACTGGAAATATTGGGAAGCATAATTAACGGATTCGCCTTACCACTGAAAGAAGAACACAAGATCTTCCTACTGAAGGTGTTGCTGCCTCTGCACAAAGTGAAGTCCCTGAGCGTCTACCACCCCCAGCTGGCGTACTGTGTAGTCCAGTTTCTAGAAAAGGACAGCACCCTCACCGAACCAGTGGTGATGGCACTTCTCAAATACTGGCCAAAGACTCACAGTCCGAAAGAAGTGATGTTCTTAAACGAGCTGGAAGAGATCCTAGATGTGATCGAACCGTCGGAGTTCGTCAAGATCATGGAGCCACTCTTCCGGCAGCTGGCCAAGTGTGTCTCCAGCCCCCACTTCCAGGTGGCCGAGCGAGCACTGTACTACTGGAATAACGAGTACATCATGAGCCTCATCAGCGACAACGCGGCGAAGATCCTGCCCATCATGTTCCCGTCCTTGTACCGCAACTCGAAGACCCACTGGAACAAGACAATACATGGCTTGATATACAACGCGCTGAAACTGTTCATGGAGATGAACCAGAAGCTGTTTGATGACTGCACCCAGCAGTTCAAAGCAGAGAAACTGAAAGAGAAGCTAAAAATGAAAGAACGTGAAGAAGCGTGGGTTAAAATAGAAAATCTAGCCAAAGCAAACCCCCAGGTACTGAAAACAGAGCGTAACATGAAAGCGTCTAGGGTGTTTGTCACTTGAATGTATTTTAAGGTAGGCGTGCGGCTTCGTCACGGGACGGGAGAGAAATCGCGTCACTGACATTGTATATGAAAATATCTGCAATAAAAATAATGTTCAA