Transcript asmbl_22613

Sequence
Transcript Sequence for observation asmbl_22613 of TGE0006294:
GGGAGACCAGCAAGCCGGCGCGGCTGCGGCAGGAGGATGCCGTGCCAGTGAGCTGGGGAATATGTACTCGCGGCTACAGGGGCTGAGTTCGTCGGGTCGTGCAGCCAGGCTAGTTTCCGCCGCTGGCTGCCTGGGTCCTCCGGGTCTTCGAAACGCTTGCAGCAACCCCCTGCCACGGTTGGTCGCGCCGGGCTCGCCGGTGCTCCTTCCGCCCCGCCCCCGGGCCGGAAGTGCGGCGCCGCCACTGTCCCGCCCCAACCTCCGCTGGTCGCAGTCGCCGGTCGGATCCTCTCGGGTGTGCAGCATCAGGTCAGATTTAAACCGCCACCATGTCGAGCAAAAAAGCGAAGACCAAGACCACCAAGAAGCGCCCTCAGCGCGCAACCTCCAATGTGTTCGCCATGTTTGACCAGTCCCAGATCCAGGAGTTCAAAGAGGCCTTTAACATGATTGACCAGAACCGGGATGGCTTCATTGACAAGGAGGACCTGCACGACATGCTGGCGTCTCTGGGGAAGAATCCCACTGATGCCTACCTGGACGCCATGATGAACGAGGCCCCGGGCCCCATCAATTTCACCATGTTCCTCACCATGTTTGGGGAGAAGCTAAACGGCACTGACCCCGAGGACGTCATCAGAAACGCCTTCGCTTGCTTTGATGAGGAAGCCACAGGCACCATCCAGGAGGATTACCTGAGGGAGCTGCTGACCACCATGGGCGACCGCTTCACAGACGAGGAAGTGGATGAGCTGTACAGAGAGGCCCCCATTGACAAAAAGGGGAACTTCAACTACATTGAGTTCACACGCATCCTGAAGCACGGCGCGAAAGACAAAGATGACTGAAGAGCTGCGGCGGCTGACACGCCTCTTGCGTTTGCTTGCTCACTTCCTGTCTCAGACACACACACCCCATAGGACCTACTGCGTGCCACTTAGTTTCTCAGTCACTTCCCCTCCCCCATAGGGCCTACTGTGTGCCACTTAGTTGAGAGCTTTTTTTTTAAATGTATTTATTCCAGGCCCTTTCTGTCACTTAGCATGTGCATAATCAGACTGGAACGGGGGACAATGTTGTAAATTGTACTGAAAACGAGATGCAAATAAAAAATGAACCACTGTGAAAGCCCAGGACAATATATCCGGATTTCTGGTTTTGC