Transcript asmbl_71475

Sequence
Transcript Sequence for observation asmbl_71475 of TGE0007458:
CCGTTGGTGATTCCGGAAGAAACCAGAGTGCGGCGTGAACATGGGAAAGCAAAAGAAAACAAGGAAGTATGCGACCATGAAGCGAATGCTTAGTCTCAGAGATCAGAGGCTTAAAGAAAAGGATAGATTAAAACCTAAAAAGAAAGAAAAGAAAGATCCCAGTGCACTCAAGGAAAGAGAAGTCCCCCAACACCCTTCTTGCCTATTCTTCCAATATAACACACAGCTGGGGCCCCCTTACCACATCCTGGTTGATACCAACTTTATCAACTTTTCCATTAAAGCCAAACTGGACTTAGTACAGTCAATGATGGACTGTCTGTATGCCAAGTGTATCCCTTGTATAACTGACTGTGTAATGGCTGAAATTGAGAAATTGGGGCAGAAGTATCGAGTGGCTCTAAGGATTGCCAAGGATCCAAGATTCGAACGATTACCATGCACACACAAAGGAACCTATGCAGATGACTGCTTAGTACAGAGAGTAACTCAGCACAAGTGTTACATTGTGGCCACGGTTGACCGAGACCTTAAACGAAGAATCAGAAAGATCCCTGGAGTTCCCATCATGTATATTTCTAACCATAGGTACAACATTGAGCGGATGCCCGATGATTATGGAGCCCCTAGGTTCTAATTCTTAAAAGATAAAATTCATCTGCTTTCCTTCAACCAACTTTCTCTGTTGCCAGTTTATTAAACATGCTACAGCATGAATTATTCTACTCAGACATTTGCTCTGTTATAAGCTGAGTATGGTTAAATACACTCAGTTTTTGATATTTGAAAATGATATTTTTGTATCATTTAAAAATTTGTTGCATTTTTTTATAGATCAGATGACTGCTCACAAATTTAATGGTTGTTTTATATTGATTTACTCAAATATTTATTAAGGTTATACTAGGTACTTAATAAGATAGGGTCCTCAAGACACTCATAGTGGGAAAGAGGAGCATGTAGGTGAATAAATATAGTAAAATAATAATGCTAAGATAAAAGTATGAGGAGTAGACACATAAAAAAGATGATTTTTTTCTATTCAGTTGGGGTGGGAAGGGAGGAAAAGCTAAAGGTAGCAATGTTTAAGTTCATCTTTTTTTAAAATTTATTGGGGTGACACTGGTTAATAAAATTATATAGGTTTCAAGTGTAC