Transcript asmbl_21770

Sequence
Transcript Sequence for observation asmbl_21770 of TGE0032516:
CTCCCAGCAGAAAGCCCTCGGAGCCCGGGGGCCGGGCGCGGGGCCTTGTGGGAGGGCTTAAGGAAGTAAAATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCGTCGCACCGTCTGTCTTTGTGTTTCAAAAGGACAAAGGACAGAAGAGATCTGCTGGCAGCTCCAGTCCCGAAGCCGGAGAAGATTCTGACCATGAGGATGGAAACTACTGCCCCCCTGTCAAGCGTGAGCGGACATCCTCTCTAACTCACTCAGAAGAGAAGAGCAGCGGCTTCCGGCTGAAGCCCCCAACACTCATCCACGGTCAGGCACCCAGTGCAGGTCTGCCCAGCCAGAAACCCAGGGAACAGCAGCGTGGTGTGCTCCGTCCAGCTGTGCTGCAGGCCCCTCAGCCCAAGGTGCTGTCGCAGACGGTTCCCAGCAGTGGCACCAATGGAGTCAGTATGCCAGCAGACTGCACGGGGCCAGCAACGTCTGTATCACCAGAAAACCTCACGCAGAGGAGTCCCTCTGAGTCTGCCGAGGAGACACACACACTCGAGGAGAAGGTGCCTCAGAAAACCCCACATGGCACCTCAGAGGAGGGGCACTGTGAAGAGGAGCAGGCGGCCCCACAGGCCTTTGTGTTTGGACAGAACTTGAGAGACAGAGTGAAGTTAATGAATGAGAATGCCAGCGTGGCAGATGTAGACAGTGCTGCACATCCCAGCTCAGAAACACCCTCTGCGACCAACTACTTCCTTCAGTACATCAGTTCCAGCGCAGACAACGCGACCCACAGTGCTGACAACTCCACCAAGTTTGTGTTTGGCCAGAACATGAGTGAGCGCGTCTTGAGCCCCCCAAAGCTGAATGAAGCCAATTCAGACACCAGCAGGGAGACTACACATGCCCAGTCAGGTTCTGAGTCGTCATCCCAGGAGGCCGCCCCCAAGAAAGAGTCCCTGGCAGAGTCAGCCGCTGCCTATACAAAGGCTACAGCGTGGACGTGTTTGCTGGAGAAGGTGGAGGTCATCACGGGGGAGGAGGCAGAGAGCAATGTGCTGCAGATCCAGTGTAAGCTGTTTGTGTTCGATAAGACCTCACAGTCATGGGTGGAGCGTGGCCGGGGACTTCTCAGGCTCAATGACATGGCGTCAACCGACGATGGCACATTACAGTCCCGGCTAGTGATGCGGACCCAGGGCAGCCTGCGGCTCATCCTGAACACGAAGCTGTGGGCACAGATGCAGATGGATAAGGCCAGTGAAAAGAGCATCCGCATCACAGCCACCGACGCTGAGGACCAGGGTGTCAAGGTTTTCCTGATCTCGGCCAGCTCCAAAGACACAGGCCAACTGTATGCTGCACTGCACCACCGCATCCTGGCTCTGCGTAGCCGGGCTGAACAGGAACAGGAGGCCAAGGCGCCCCCACCTGAGCCAGGAGCCACCCGGGCCACCGAGGAGGAAGACAGTGATGAGGATGCTGTTCTGGCTCCCTCCGGTGTCACGGGGGCTGGCACAGGTGATGAAGGAGATGGCCAGGCTCCTGGGAGCACATAGCGGCGGAGCCACTGCACCAGGCTGCTGCTTTGTTGTCTGTCTGCTGCCCGTCCCTCCCTGCAGGCCGCATCATGGTGGTGTCTATTGCCGGGGTGGCCACAGGCTGGATCCGAGTGTCCCCTCTGCAGCAGACGGGGACGCCAGGATGCGGCTTGGGACTCAGACCTCATCATATTGATGAGTAGAAAGAACGTTCCCCCGCCCTCCTCCGATCGAAATGGCACATTGACACTTGTCACAGCTTCGTGGTGACCGTCCATCCCTGGGCAGCAACAAAGAGAACTCCAGGCTCAGCATTCTGTTGAGTAACTTGCTACCTGCTCGGCTTTCCACTCTGCCAGGTCCACATGGCAGGTGCCTCTCCTTCATTTCTGGTGGCTTGGCTCTTGAGGTCACAGATGAAGCTACACGTGGGCTGAGCTGACTTGATGCTCCTATGGGTGGTGCCCGGCCCCCACGGGGGTTCACTAGGTTTGGGCCTGAGAACACCTGTCTGGACAAAGGTGATGAAACCAAGAGAGCTCCTGCCTTCTTGCCTGCCTACGTGAACCACCTGGGTCTCCCTTAGCAGGTACCCAGCCCTGAGGTGACTGACCACCTAGGGCCCCTGAGAGGCAAAGGGAACCTGCAAAGGGCCTGTCCCCGGGCAGAAGATGAAGCCCCTACCCGTGGACTGTGTGGTTCCATCTCTGGCCAGGCCACTTCCAGCCAGCAAGGACACCAGAGGCTGCCTTAGCAGATGGGTCACACTGCTTCCAGCCTTAGCCAGCCAGTGACAAGTGAATCCAGACGTCACCCATGTGTTTTGGAACATTTATGTAAGATTGAAATGTATTTGAGAACTGCATTAAAACTTTTAACTAAA