Transcript asmbl_24920

Sequence
Transcript Sequence for observation asmbl_24920 of TGE0000759:
GCAGATAATGGGAGGAGCCGGGCCCGAGCGAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCGCCTCTAGTGTCCTCCGCTGTGGCAAGAAGAAGGTCTGGTTAGACCCCAATGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCCGGAAGCTCATCAAAGATGGGCTGATCATCCGCAAGCCTGTGACGGTCCATTCCCGGGCTCGATGCCGGAAAAACACCTTGGCCCGCCGGAAGGGCAGGCACATGGGCATAGGTAAGCGGAAGGGTACAGCCAATGCCCGAATGCCAGAGAAGGTCACATGGATGAGGAGAATGAGGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATCGATCGCCACATGTATCACAGCCTGTACCTGAAGGTGAAGGGGAATGTGTTCAAAAACAAGCGGATTCTCATGGAACACATCCACAAGCTGAAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCCCGCAGGTCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGCCTCCAGGCCAAGAAGGAGGAGATCATCAAGACTTTATCCAAGGAGGAAGAGACCAAGAAATAAAACCTCCCACTTTGTCTGTACATACTGGCCTCTGTGATTACATAGATCAGCCATTAAAATAAAACAAGCCTTAATCTGC