Transcript asmbl_21378

Sequence
Transcript Sequence for observation asmbl_21378 of TGE0003604:
CGGGCTCTATTTGAGCGCATGCGCAAAGCGCTCTGCCTTCTTTCCGGTTTCCGCGGCAGCCGCAGCCATGAGCAGCAAAGTCTCACGCGACACCCTGTACGAGGCGGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGCAAGTTTCTGGAGACGGTGGAGCTGCAGATCAGCCTGAAGAACTACGACCCTCAGAAGGACAAACGTTTCTCGGGCACCGTCAGGTTGGCACCGCTCTAACCCCACCCAGCCCTCAGTGTTCCCGTGTGGCCTGGCCGCGCCCTAGGCGGGCACGGGGACACTGACGTGCCAGGGTAGTTCAGGAGCCCTGCTGCAGGCAGGCAGGCTGGACGGACCCCCACCCTGGGTCTTAAAACAAGAGGGGAGGCGTGGGGAGGCCTCGGCCGAGCCCGCCGCCTAGCCTGAGAAGCCAGGCTAGTGTTGCCCAGAGCTCCGGGCTCAAGTCCACCCCACGCCCCAAGTTCTCGGTGTGCGTTCTGGGGGACCAGCAGCACTGTGATGAAGCCAAGGCCGTGGATATCCCCCACATGGACATCGAGGCGCTCAAGAAGCTTAACAAAAACAAGAAGTTGGTCAAGAAGCTGGCTAAGAAGTACGATGCCTTTTTGGCCTCTGAGTCTCTGATTAAGCAGATCCCACGTATCCTGGGCCCAGGCCTAAACAAGGCTGGCAAGTTCCCCTCCCTGCTGACACACAATGAAAACATGGTGGCCAAAGTGGATGAGGTGAAATCGACAATCAAGTTCCAGATGAAGAAGGTGCTGTGTTTGGCCGTCGCTGTTGGCCACGTGAAGATGACCGATGATGAGCTAGTCTACAACATTCATCTGGCTGTCAATTTCTTGGTGTCCTTGCTTAAGAAAAACTGGCAAAACGTGCGGGCTCTGTACATCAAGAGCACCATGGGCAAGCCCCAGCGTCTGTATTAGGATGCTCCAATAAACCTCACTGCTGCCACTCA