Transcript asmbl_21242

Sequence
Transcript Sequence for observation asmbl_21242 of TGE0005013:
CCGCGGCGCCTCCCTCTTCTTCTTCTTCGGGAGAACACCAAATGGCGGATGACGCCGGTGCAGCGGGAGGGCCCGGAGGACCCGGGGGCCCAGGATTAGGTGGCCGCGGCGGCTTCCGCGGAGGATTCGGCAGCGGTCTTAGGGGCCGTGGTCGTGGCCGAGGCCGTGGCCGTGGTCGAGGCCGCGGGGCTCGTGGAGGTAAAGCTGAAGACAAGGAGTGGATCCCCGTCACCAAGCTGGGCCGTCTGGTTAAGGACATGAAGATCAAGTCCTTGGAGGAGATCTACCTGTTCTCCCTGCCCATTAAGGAGTCTGAGATCATTGATTTCTTCCTGGGTGCGTCCCTAAAGGATGAGGTTCTGAAAATCATGCCAGTGCAGAAGCAGACTCGGGCTGGCCAGCGGACCAGGTTCAAGGTTGGTTAAGATTGCTTTTTTGGCCGTGAGGTTGAGCAAAACTCTCTCACTCTGCATGGTTACACAAGGTTTTACCCGTGTGACTTTCGTACGGAGAGAGAGAGAAAACGAGTTCCTTCAGGACTTTGGATTGGCCTCACAGTGGCCTCTCTTGCCTAGAGGAGCACCACAGGTCCTCTTTGGGATGTGCTGGTGCCATGACCTGTCTCCAGCCATTTCACCTAAGTCTTCTCATAGGCTTTCGTCGCTATTGGGGACTACAATGGTCACGTTGGTCTTGGTGTTAAGTGCTCCAAGGAGGTTGCCACTGCCATCCGAGGGGCCATCATCTTGGCCAAGCTTTCCATCGTCCCTGTGCGGAGAGGCTACTGGGGGAACAAGATTGGCAAGCCCCACACTGTTCCATGCAAGGTGACAGGCCGCTGTGGCTCTGTGCTGGTGCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTCTCTGCTCCTGTGCCCAAGAAGCTCCTGATGATGGCCGGTATAGATGACTGCTACACTTCAGCCAGAGGCTGCACTGCCACCCTGGGCAACTTTGCTAAGGCCACCTTTGATGCCATCTCCAAGACTTACAGCTACCTGACTCCCGACCTCTGGAAAGAGACTGTCTTCACCAAGTCTCCTTATCAGGAATTCACGGATCATCTTGTGAAAACCCACACCAGAGTCTCTGTTCAGAGGACCCAGGCTCCAGCTGTGGCTACCACATAAGGGTTTTTATATGAGAAAAATAAAAGAATTAAGTCTGCTGA