Transcript asmbl_201

Sequence
Transcript Sequence for observation asmbl_201 of TGE0032174:
CATCAGATTAGACCCTTCTCAGCCACCGTCGCCCAGTTCCCTTCCGACTCGTTCTCCTTTCCCGAGTTTCCGCTCTGAAGCCAGAGGTACTTGATGTGTGCGGGCTGGGCGCTGGTGGAAATCGAACCTCGTGGTATGTTCTGTAGGAACCTGAGGGAGCTAACTGAAGCCTAGCTCCTGCTGCGCTTGCGGCGCAGTCTACCTTAGAGCTGCTTGATTATCAACGCACACATTTTCGTGGAGAAGTCTCGTGTGTATATTCAGCCATGGCACAACTCCAGGCACGTTTCTACAGCGAGAACAAGAAATACGCAGTGGATGATGTCCCTTTCTCAATCCCTGCCGCTGCTGAAGTTGCGGACCTTAGTAACATTATCAATAAGTTGCTGGAGACCAAAAATGAACTCCACAAGCATGTCGAGTTTGATTTCCTTATCAAGGGCCAGTTTCTTCGAGTGCCCTTGGTCAAACACATGGAACTGGAGAACATTTCATCGGAAGAGGTTGTGGAACTAGAATATGTGGAAAAGTACACCGCACCCCAGCCAGAGCAGTGCATGTTCCATGATGACTGGATCAGCTCAATTGAAGGGGCAGAAGAATGGATCCTGTCTGGTTCTTATGATAAGACTTCTCGGATCTGGTCCTTGGAAGGAAAGTCGATAATGACAATTGTGGGACATACAGATGTTGTGAAAGATGTGGCTTGGGTGAAAAAAGACAGTTTGTCCTGCTTACTACTGACGGCCTCGATGGACCAGACTGTTCTCTTATGGGAGTGGAATGTAGAGAAGAACAAAGTGAAAGCTCTGCACTGCTGCCGAGGGCATGCTGGGAGTGTGGACGCCATCGCAGTCGATAGCTCGGGAGCTAAGTTTTGCAGTGGCTCCTGGGATAAGATGCTAAAGATCTGGTCTACAGTCCCTACAGATGAAGAAGATGAAATGGAAGAAGCCACAAATCGACCAAGAAAAAAGCAAAAAACAGAACAATTGGGACTAACAAGAACACCCTTGGTGACCCTCTCTGGCCACACAGAAGCAATTTCCTCAGTCCTTTGGTCAGACGCTGAAGAAATCTGTAGTGCATCTTGGGATCACACAATTAGAGTGTGGGATGTTGAGTCTGGCGGTCTTAAGTCAACTCTGACAGGAAATAAAGTGTTTAATTGTATTTCCTATTCTCCCCTTTGTAAACGTTTGGCATCTGGAAGCACAGACAGGCATATTAGACTGTGGGATCCCCGAACTAAAGATGGTTCTTTGGTGTCGCTGTCTCTCACCTCACACACAGGCTGGGTGACATCAGTGAAGTGGTCTCCTACCCATGAACAGCAGCTCATCTCGGGCTCTTTAGATAACATTGTGAAGCTATGGGATACAAGAAGCTGTAAGGCTCCTCTCTACGATCTAGCTGCTCATGAAGACAAAGTTCTAAGTGTGGACTGGACAGACACAGGGCTACTTCTGAGTGGAGGAGCAGACAATAAATTGTATTCCTACAGCTATTCCCCTACCACTTCCCATGTGGGGGCTTGAAAATGAATGGCTGAGAAGAGACTTCCTTGTTGGGTCTTGTCTTAATTCTTAGTGTCTCACTGTTATTTCATAAACTGAATCAAATTTGAGAGAGGACTTATAGTACAGCTCAGCTGGTAGAATGCTTGCCTAAAATGTGCACAGCCCTGCATGCTATCTCCAGCACTGCCCAAAGAAAAATGGGCATGGTAGCACATTCCTGTAATCCCAGTCCTAGAGGTTGGAAGCAAGAGCATCAGAAATTCAAGGTCACCCTCTGCTGTATAGTGAGCTTAAAGGCAGCCAGCCATGGTTCCCTGAGTCTCTGTCTCCATAAGAAAGAAATCAATGGATAATCCTCTGATATCATTGTCAATGCAGAGACAGGAAGCAGCCTTTTAAAATTTGGATAACAGTTCATCTTTCATAATAGCAACATTTTACTGTCTTTGTCCTTCGTGCTTATAAAATACAGTAAGTATGTGGTCTGAATTCTGTCTACATTTTACCCTATGTAGACTCCTAAAACTTGAATTTCAGAAAGTATACTTTTT