Transcript asmbl_19915

Sequence
Transcript Sequence for observation asmbl_19915 of TGE0007598:
CTTTTGGGGCGGTACTCTGCCCTGTCTTACTTTTCTCCACGTGAGGGGGTGCGCGAATCCCCAGTGGTGGCCGCGCGCTCACATCCTCTGCAGCTTTCGTGCCCTTCGCGATGGCGGGCATCCTGTTCGAGGATATTTTCGATGTGAAAGACATCGACCCAGAAGGCAAGAAATTTGACCGAGTATCCCGGCTGCACTGTGAGAGTGAATCTTTCAAGATGGACCTCATCTTAGATGTAAACATTCAGATTTACCCTGTGGACTTAGGTGACAAGTTCCGGTTGGTTATAGCTAGTACTTTGTATGAAGATGGTACCTTGGATGATGGTGAATACAACCCCACAGATGACAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTCATGTATGGGAAAGTGTACAGGATCGAAGGGGATGAGACCTCCACTGAAGCAGCCACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTTCAGGGTGATGCCAACAACCTGCATGGATTTGAGGTGGACTCCAGAGTTTATCTGCTGATGAAGAAGCTGGCCTTCTGAACTTCGTGGGAAACCAGACTTGCTGCTTAGTCACTCATGTCATGGACACTGTTCAAGGCTGTGTAGAAGCTGTCGGTGTTAGCCTGTAAAAGGGGCGGAACTCTGTCCACTGTGGGGACGTCTTCAGTTTGTCTGAATGCAGTGGAAAACCGACTCTCCCTCTCGGAAGGCCGAGAGGGAGAACTTAGCATGAACCTGAAG