Transcript asmbl_198

Sequence
Transcript Sequence for observation asmbl_198 of TGE0032174:
CCCTAAATGCGGTGTGGCAAAATAAATAAAGCCTACAACTCCCAGTGTTCAGAGGGTACTTGATGTGTGCGGGCTGGGCGCTGGTGGAAATCGAACCTCGTGGTATGTTCTGTAGGAACCTGAGGGAGCTAACTGAAGCCTAGCTCCTGCTGCGCTTGCGGCGCAGTCTACCTTAGAGCTGCTTGATTATCAACGCACACATTTTCGTGGAGAAGTCTCGTGTGTATATTCAGCCATGGCACAACTCCAGGCACGTTTCTACAGCGAGAACAAGAAATACGCAGTGGATGATGTCCCTTTCTCAATCCCTGCCGCTGCTGAAGTTGCGGACCTTAGTAACATTATCAATAAGTTGCTGGAGACCAAAAATGAACTCCACAAGCATGTCGAGTTTGATTTCCTTATCAAGGGCCAGTTTCTTCGAGTGCCCTTGGTCAAACACATGGAACTGGAGAACATTTCATCGGAAGAGGTTGTGGAACTAGAATATGTGGAAAAGTACACCGCACCCCAGCCAGAGCAGTGCATGTTCCATGATGACTGGATCAGCTCAATTGAAGGGGCAGAAGAATGGATCCTGTCTGGTTCTTATGATAAGACTTCTCGGATCTGGTCCTTGGAAGGAAAGTCGATAATGACAATTGTGGGACATACAGATGTTGTGAAAGATGTGGCTTGGGTGAAAAAAGACAGTTTGTCCTGCTTACTACTGACGGCCTCGATGGACCAGACTGTTCTCTTATGGGAGTGGAATGTAGAGAAGAACAAAGTGAAAGCTCTGCACTGCTGCCGAGGGCATGCTGGGAGTGTGGACGCCATCGCAGTCGATAGCTCGGGAGCTAAGTTTTGCAGTGGCTCCTGGGATAAGATGCTAAAGATCTGGTCTACAGTCCCTACAGATGAAGAAGATGAAATGGAAGAAGCCACAAATCGACCAAGAAAAAAGCAAAAAACAGAACAATTGGGACTAACAAGAACACCCTTGGTGACCCTCTCTGGCCACACAGAAGCAATTTCCTCAGTCCTTTGGTCAGACGCTGAAGAAATCTGTAGTGCATCTTGGGATCACACAATTAGAGTGTGGGATGTTGAGTCTGGCGGTCTTAAGTCAACTCTGACAGGAAATAAAGTGTTTAATTGTATTTCCTATTCTCCCCTTTGTAAACGTTTGGCATCTGGAAGCACAGACAGGCATATTAGACTGTGGGATCCCCGAACTAAAGATGGTTCTTTGGTGTCGCTGTCTCTCACCTCACACACAGGCTGGGTGACATCAGTGAAGTGGTCTCCTACCCATGAACAGCAGCTCATCTCGGGCTCTTTAGATAACATTGTGAAGCTATGGGATACAAGAAGCTGTAAGGCTCCTCTCTACGATCTAGCTGCTCATGAAGACAAAGTTCTAAGTGTGGACTGGACAGACACAGGGCTACTTCTGAGTGGAGGAGCAGACAATAAATTGTATTCCTACAGCTATTCCCCTACCACTTCCCATGTGGGGGCTTGAAAATGAATGGCTGAGAAGAGACTTCCTTGTTGGGTCTTGTCTTAATTCTTAGTGTCTCACTGTTATTTCATAAACTGAATCAAATTTGAGAGAGGACTTATAGTACAGCTCAGCTGGTAGAATGCTTGCCTAAAATGTGCACAGCCCTGCATGCTATCTCCAGCACTGCCCAAAGAAAAATGGGCATGGTAGCACATTCCTGTAATCCCAGTCCTAGAGGTTGGAAGCAAGAGCATCAGAAATTCAAGGTCACCCTCTGCTGTATAGTGAGCTTAAAGGCAGCCAGCCATGGTTCCCTGAGTCTCTGTCTCCATAAGAAAGAAATCAATGGATAATCCTCTGATATCATTGTCAATGCAGAGACAGGAAGCAGCCTTTTAAAATTTGGATAACAGTTCATCTTTCATAATAGCAACATTTTACTGTCTTTGTCCTTCGTGCTTATAAAATACAGTAAGTATGTGGTCTGAATTCTGTCTACATTTTACCCTATGTAGACTCCTAAAACTTGAATTTCAGAAAGTATACTTTTT