Transcript asmbl_19120

Sequence
Transcript Sequence for observation asmbl_19120 of TGE0050873:
CGTCCGGCCGCCCCGCCCCGCCCCGGCCCAGCCCGTCAGCCCGGCGACGCGCGCATGGAGGCCGGCTGAGGAGCGCCGCCGCCTCTCTCGGCATCCTACATCAATCAGGAAGCTGCTGTCCAGCCATGGAGGGAGAGGAGAAGCCAGCTCAAGAGGCTGACGTGGAACCTGTGGTAACAGCAGGCACCTCAGAAGCAGTGCCAAGGGTGCTTGCTGGAGACCCTCAGAACATCTCTGATGTGGATGCCTTCAACTTGCTCCTGGAGATGAAACTGAAACGACGGCGTGAACGCCCCAACCTTCCACGTACAGTGACCCAGCTAGTGGCCGAGGATGGGAGCAGGGTGTATGTGGTGGGCACTGCTCACTTCAGTGATGATAGCAAGAGAGATGTAGTAAAGACTATCCGGGAGGTGCAACCGGATGTGGTCGTGGTGGAGCTCTGTCAGTACCGGGTGTCCATGCTCAAGATGGACGAGAGGACGCTGCTGCGAGAGGCCAAGGAGGTCAGCCTGGAGAAGCTGCAGCAGGCTGTCAGGCAGAATGGGCTTATGTCTGGACTCATGCAGATGTTGCTGCTGAAGGTGTCTGCTCACATCACTGAGCAGCTGGGCATGGCCCCTGGTGGCGAGTTCAGGGAGGCCTTCAAAGAGGCCAGCAAGGTACCATTCTGCAAATTCCACCTGGGTGACCGACCAATCCCAGTCACCTTTAAGAGGGCCATTGCTGCACTCTCCTTCTGGCAGAAAGTCAAGCTGGCCTGGGGCCTGTGCTTCCTGTCAGACCCAATCAGCAAAGACGACGTGGAGCGCTGCAAACAGAAGGACCTGTTGGAGCAGATGATGGCCGAGATGATTGGGGAGTTTCCTGACCTGCATCGCACCATTGTCTCAGAGCGTGACGTCTATCTGACCTATATGCTGCGGCAGGCCGCACGGCGCCTTGAGCTTCCCCGCGCCTCTGATGCTGAGCCCAGGAAGTGTGTCCCGTCTGTGGTTGTGGGCGTCGTTGGCATGGGGCATGTGCCTGGCATTGAGAAGAACTGGAGTACCGACCTCAACATCCAGGAGATCATGACAGTCCCCCCACCGTCCATCTCAGGCAGAGTGTCCCGGGTGGCTGTGAAGGCGGCCTTCTTTGGTCTCCTGGGCTATAGCCTGTACTGGATGGGCCGTCGGACCCTGAACCTGGTCCTGTCACTGCCTGCTGCACAGTTCTGCCTCCAGAGGGTGAGCGAAGCCCGGCCAGGCCGGTAGGAGGACCGTGCAAGGAAGAGACTGCACCTGGGGGCTCTGCTCTGCGCCGAGTGGGGTGCTCACGAGGAGCTGGCGCCGCCCGTCTGGGGATGTCCCTGGGGACAGATGCATCCAAGCCACCCCCTATGGGGGCCTAGGCCAGGCTTTCCCTGCCTTCCCAATGCCCAGCCCACCCAAATAAAGAATATTTAACTGTCTGAGCCCAGGCTTCCCAGCAGCCCACACACACACTGTGGGGCCACCTATGGGCATCAGGGCCAACCGCAGTGTCAGGACCCAGCGGCCTAGTTCCAAAAGGACCAGAAACTGAGGGGGAGGCACTGAGACACCCCACCCTTAACCCCAGGTGGGTTTGGCAAGCTGTTGCTCTACCTACCTCACTGTGCCTTGTGCTCTGGCCGGCAGGAGCATCTGGGCCTGAGTGCATCTCACTGTGGGTTTGGGGCTGAGTGGCCATGCACCTCCCTCCTGGGTGTGTGGGGCCTGGCCTGGCCTGGACATGCATGTGGCATTGCCAGCTGCATCTCTGCCTGCAGAGAGTCTGGTTTTGTGGGGTTTTGTTTTCTGTTTTTGTTTTTGTTTTTTAATGTCAAAAAGTTTTTTACTCAGGTAATTTTGACGTCAAAGAGAAAACAAACTGAAGCAAATATCAGGAAATACAAGCCTTAAATCCAGTGAGGACAAAGAAGTCATCTTTTTATTTGTGTTTGTGTGCCCTGAGTGGGCAGTGTGTGTCAGAGTCGGCTTGGGGGTCCAGGCCAGCCCCTGCTAGACACCACTACAGCTCAGAGTGGCGTGGGGCTGCCTCAGATATGAGCCTGCAAGGCTGCCCTTGGTGTTGGTAGGACCTTAGCCTGATTGCTGTGCATTAGGTGAGAGGCCCAAACTGCACTGAGGGCAGTAGGCACCCACTATGGGCCACGGCTGGTTTGTGTGCAGCCAGCCATTCATGTGTACAGGCTGTGGCTCCTAGTATATGGCACAGCCTGGCAAGACCTAGACCACATTGATTGTCCTTGTGTTGGCTGCCAAATCAGGTGAGACACGGAGCTGGGTGGGGACACAGGGCTGGCTGGCTGTGTACTCTGTCTCACACTTGTGGACTCATTCCCTAGAAAGAAATAAATTTTAATTTTGG