Transcript asmbl_18590

Sequence
Transcript Sequence for observation asmbl_18590 of TGE0000137:
CGCACAGCTCCTGTCGCCGTCGCGGCTTCCGGTGCTAGGTGGAGGGCGGGCAGGAGGGAGCCGGGGAGCGGGCCAGCGGACCATCTTCACCGCGGTCGGGTCGGCTTGCGGAGCGGGAGGCAGCGGCCGGAGAGCCGGGCGGAACCTGCGGGGGCGGAGGCGGCGGTGGCAGCCGCGGCGCAGGGAGCAGGAACAGGGTCAAGTCCTCCATACCAAGGACCAGGCTAAAACCAGATTACACTGCCCCTCCCTGGGCCCTATTGACTTAAAGCAGCCACTGTAATCATGGGCAATATCTTTGGGAACCTTCTGAAGAGCCTAATCGGCAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCTGCCGGGAAGACCACCATCCTCTACAAGCTGAAACTCGGGGAGATTGTCACCACCATCCCGACCATTGGGTTTAATGTGGAGACAGTGGAATATAAGAATATCAGCTTCACAGTCTGGGACGTAGGTGGCCAGGACAAGATTCGGCCCCTCTGGAGACACTACTTCCAGAACACCCAAGGCTTGATATTTGTGGTTGACAGCAATGATCGGGAGCGAGTGAACGAGGCCCGGGAAGAGCTGATGAGGATGCTGGCGGAGGATGAGCTCCGGGATGCTGTGCTCCTTGTGTTTGCAAACAAACAGGATTTGCCGAATGCTATGAATGCTGCTGAGATCACAGACAAGCTGGGGCTGCACTCCCTGCGTCACCGCAATTGGTACATTCAGGCCACCTGTGCTACCAGCGGGGACGGGCTGTATGAAGGCTTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGAGAGCCAGGCAGCCCTCTCTGACTACCCCACCCACTCCTGACACACACCTGCTGTCTCCTTACCCCAATTTTCCCTTCTTCCTCTTGAAAGTGGCCAAGGTCCTGGGTATCATGTCCACATGCCCAGCAAGCGCCTTGCCTTCCTCCTCCTCCTCCTCCTCCCTCCTCCCTCCTCCCTCC