Transcript asmbl_18353

Sequence
Transcript Sequence for observation asmbl_18353 of TGE0032237:
ATTTTGTGCAGTTGCTGGGAAGGAAGGGAGACGCCTCAACCGTGGCACCGCCCGGTTTGAGCGGGACCAGACCTCCCGACTGTCCTAACAACCCCGATTCTCTGAGTTGTGCTCCCGTCTCCGACGAGAGAGGCGGCGACGGTGGCGTCTGCGACGGGAGACAGCGCGTCGGAGCGAGACAGCGCCGCGCCTGCCGCCGCCCCAACAGCGGAGGCGCCGCCGCCGCCATCGGTCATCACTAGACCCGAGCCGCAGGCCCTCCCGAGCTCGGTCATCCGTGCCCCGCTCCCAGATCTTTATCCGTTTGGGACCATGCGTGGAGGCGGCTTTGGGGATCGGGATCGTGACAGGGACCGTGGAGGGTTTGGAGCAAGAGGTGGTAGTGGGCTTCCCCCTAAGAAGTTTGGTAATCCTGGGGAGCGGTTACGAAAAAAGAAGTGGGATTTGAGTGAACTCCCTAAATTTGAGAAGAATTTTTATGTTGAGCATCCAGAAGTAGCAAGACTGACTCCGTATGAGGTTGATGAGCTACGGCGTAAGAAAGAGATTACAGTGAGAGGGGGAGATGTTTGTCCAAAACCTGTCTTTGCCTTCCATCATGCTAACTTTCCACAGTATGTGATGGATGTGCTGATGGATCAGCACTTTACAGAACCCACTCCCATTCAGTGCCAGGGATTTCCTTTGGCTCTTAGTGGCAGGGATATGGTTGGCATTGCACAGACTGGCTCTGGGAAGACATTGGCGTATTTGCTGCCTGCGATTGTTCATATAAACCACCAGCCATACTTGGAAAGAGGAGATGGTCCAATTTGTCTAGTGCTGGCTCCTACCAGAGAGCTTGCGCAGCAGGTGCAGCAGGTGGCTGACGATTATGGAAAATGCTCCAGGTTGAAGAGTACGTGCATTTACGGAGGTGCTCCTAAAGGTCCCCAAATTCGAGACTTGGAAAGAGGTGTTGAGATTTGCATAGCCACTCCTGGGCGCCTAATAGATTTCCTGGAGTCAGGAAAGACAAACCTTCGCCGATGTACTTACCTTGTGTTGGATGAGGCTGACCGGATGCTTGATATGGGCTTTGAGCCCCAGATCCGTAAAATTGTTGATCAAATCAGGCCTGACCGGCAGACACTGATGTGGAGTGCAACCTGGCCGAAGGAAGTGAGGCAGCTTGCAGAGGATTTCCTGCGGGACTACACCCAGATCAATGTGGGCAATCTGGAGCTGAGTGCCAACCACAACATCCTACAGATTGTAGATGTCTGTATGGAGAGTGAAAAAGACCACAAATTGATCCAGCTGATGGAGGAAATCATGGCGGAAAAGGAAAATAAGACTATAATATTTGTGGAGACAAAGAGGCGCTGTGATGACCTCACACGAAGAATGCGCAGAGATGGTTGGCCTGCTATGTGTATCCATGGAGACAAGAGTCAACCAGAAAGAGATTGGGTACTTAATGAGTTCCGATCTGGAAAGGCTCCTATCCTCATTGCCACGGATGTAGCCTCCCGTGGGCTAGATGTGGAAGATGTCAAGTTTGTCATCAACTACGATTATCCAAACAGCTCAGAGGATTATGTTCACCGTATTGGCCGAACGGCCCGCAGCACCAACAAGGGCACTGCCTATACTTTCTTTACCCCGGGCAACCTGAAGCAGGCTAGAGAGCTGATCAAAGTATTGGAAGAGGCCAATCAAGCCATCAATCCAAAATTGATGCAGCTTGTGGACCACAGAGGTGGCGGCGGAGGAGGGGGAGGCCGCTCACGATACCGGACTACTTCTTCAGCCAACAATCCCAATCTGATGTATCAGGACGAGTGTGACCGGAGGCTTCGAGGGGTCAAGGATGGTGGCCGGAGAGATTCTACAAGCTACAGGGATCGTAGTGAAACCGATAGAGCCAGTTATGCTAATGGCAGTGGCTATGGAAGCCCAAATTCTGCCTTTGGGGCACAAGCAGGCCAATACACCTATGCTCAAGGCACCTATGGGGCAGCTGCCTATGGCACCAGTGGCTACACGGCGCAGGAGTATGCTGCTGGCACTTACGGGGCGAGCAGCACTGCCTCAGCAGGGAGGAGCTCTCAGAGCTCCAGCCAGCAGTTTAGTGGGATAGGCCGATCTGGGCAGCAGCCACAGCCACTGATGTCACAGCAGTTTGCACAGCCTCCAGGAGCTACCAATATGATAGGCTACATGGGGCAGACTGCTTACCAGTACCCTCCCCCTCCCCCTCCCCCTCCTCCATCTCGCAAATGAAACTGCATGGCAGGAGTGACTCGTGCAGATGAATTACACATCTAAAGGAACACTGTCTTTTACCCTTCTAGACCTTTTCATTTTTATTTTTTCTTTTCTCAACCATTACGGTTTATCTTTTTTTAATGCAGATAGTTAAAATTTCACTGCCAGGTTTCTTCTGCCCACCCAAAAGATCCAGTCTATAATTACAGATTTTGTAAGAAAAAATATATATACACATAACTGACTGGAAAGAATTAATTTCTTTCCCCCAGCTTAATGCATGTTGAGGATATTGAGCTATTTTTCATCTTAAAGGTATTAGGCACTTTTGTTGGAGCCTGTTTATCCATGGGAGGGTGGGTAGGGAAGGAGGGACTGCTCTGCAGGAAGTGGTATCTGTTCTTTAGACTGCTCTCCTTAGGGAGGAGCCAAGAGGGATTTCCATGCACACTGCCCATGGTGGGTTTAAGTTACTGAAGTTCGATTACTCAGGCCTGATGAATTTTTAAGACTGCTTTGTTGGTCATTTGGCTGATGGCTTCTTATGTGCATTCAACAGTTAAAAATTCCTAATCGATTCTGTCATCATGCCCCCTCCCCACTTGTTCCTGCAGTTATTAAATATTAACCAGGTTAGTGTTGAGTTAGAAATTACATTTCTGAGTTCAAGCGTTGTCTTTTTAAGTTTAAAAAACTATAAAGGGTTGTTTTTACTAGGTAGACTGGCATCTGGGTAGAGGCTGCCTGGGATTTTTATCCCCACATAACCAGGGGCCATCTGAAAGTCATTTTCTAGCCAGATCAGCCACTGAGCGGTAAGCATCAGCGCTCAGCAGAGCCTTCCGAGCAGCATTTAGAAAGCACCTTTGGGAATGATGGACTGCAAGGGAGTGGGCGGATCTTCCTCTTAAACAGTATTCTTAGAGTAGGATTGACCTCATGGGCTGCTCTGCCCACTTGGTCAGGCTCTCCTGAGCAGGACTGCTAAAGAGCTTGCCTCCTCAAAGCCTGGTCTCTGAGGTGCTTTCTAACAGCTGGAGGCACTTGTTCTGGGCTTTCCTTTGCCCTCAGTTTTTCACAGGTAGGTAGTAGCCATGGAGGGCTGAAGCCCAGGCTCTCCTTACTCTCTGGAGTGTGAAGGTAGGGGTGAGCTCGTCTCACCCCTTTATTAAATGCTCCTGGAACTTGGAAGAGCAGCAGATGAAGTTGGAAAGAAAATTCTGCTCTTATCACCTAAACAGGACAGGAGAGCAGATGCCCCAGCGCCTCTAGTAGATGGTAGTGGTGGGGCTAGTGTGTGGCTGTTACCTGGGCCGCTCAAATTCATTCCAGGGAGGAGGCTCCACTGCATTCTTTGGCTGTGCCCTGAGGGTGCCTGCTCCTTTGTACGGTAACAGTCAATTTTGAGGTTTCTTTCAGGAAGAGAAAGGGATGGTTTTGAGGGGCTCAGAAAATAGGATTCAGTGTGTAACATAACAGGTAGGTTGTCAGCATGCTTGGCATTCTTCTGTTTTCCTTACCGTTTTACAGACTATGAAGCTGAGGGGGGATGGTAGGCACAGATGTGTGGCAACCCTGCTCTGTGCTCTGAAACCAAAGTGTGTCCTGTCTTGTCTGTCTCTCACCCTGCCAAAAGCAAGTGTCTAATCACTGATGCTGACCAGCCTGTTACAGATACTTTCTACAACCAAATTCAGATTTATTTTTTATTAAGCATTATACCATGGGCTGTCCTGTGCTCCTGTCACTCTTCAAAAACACCCCTTCTATTACTGCCTCCGGGGATGAAGCAGTAGCTAGGTTGCTTAACCTCCCCTCTCCAGCAGAGGCATAATCCAGATAAGTAGCAGATGTCATATTTCATAAGCTCTTTTGGCCTGGGTACAGCAGAAAACTAGCAGTTTTCCTACTTGGCGCAAGTGACTTGTGCCTCCTTGTCTGTCCTTTGTCAGCACAGGTGCAGGCAAACCCTTCCAGCTGGGTTAATTGCCGTTTATGGTTTACTCACTTAGGGAAAGGGCTTAGGTGTTAGGCTGTGGGCTGCTTCTCCCTAACCATCCATTGTGCAGACTTCTCATCTAAAAAGGTTGGTGGCTTTTGCTTGGGATCAGTGCTCTGCTAACGCCCTTGCTGGTCTCTCCACACATTCCTGTCATTGAGACTTGAATTGTAGGTGTGATGTTATGCACAGGATGCTCAGAGCTATGTTACTACTATTCTTAGTTTGTAAATTGTCCTTTTGATACCATCTTGTTTTCTTTTGTAGGTATAAATAAATACTTGACAATAAA