Transcript asmbl_18058

Sequence
Transcript Sequence for observation asmbl_18058 of TGE0050786:
GCCGGCGCGCAGCCCCGGGCCGCGACGCGATGCCCGGCCGAGCACGAGGAGGACATGTACCGTGCTGCAGATGAAATAGAAAAGGAGAAAGAATTGCTAATACATGAAAGAGGGATATCAGAACCCAGGTTAAGTGTGGCTCCTGAAATGGATATCATGGACTACTGCAAAAAAGAATGGAGAGGAAATACTCAGAAAGCCACATGTATGAAAAAGGGCTATGAGGAAGTGTCTCAGAAATTCACTTCCATAAGGCGAGTCCGTGGTGATAACTACTGTGCACTGAGGGCCACACTGTTCCAGGCCATGAGCCAGCTGGCCGAGCTGCCCCCCTGGCTGCAGGACTTGGAGCTCATACTGTTACCAGAGAAGCTGATAAACAAGTATACCTGGATCAAGCAGTGGAAACTTGGACTGAAATTTGATGGGAAGAGTGAGGACCTGGTTGAAAAAATTAAGGAATCCCTTGCCCTGCTAAGGAAGAAGTGGGTAAGCCTGGCTGCAATGAAAACTGCTGAAGCGAGGCAGACAGCTTGTGATGAGCTGTTCACCAACGAAGAGGAGGAGTACAGCCTCTACGAAGCTGTGAAGTTCCTGATGTTAAACAGAGCCATCGAACTGTACGATGACAAGGAGAAGGGAAAGGAAGTGCCGTTCTTCTCTGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCTCCTGAGGAACCACCTAAACCAGGTGGGACACACGGGGGGCCTTGAGCAGGTTGAGATGTTCCTTCTTGCCTATGCTGTCCGCCACAGCATCCGGGTGTACCGGCTGTCCAAGTATAACACAGAGGAGTTCATCACAGTCTACCCCACTGATCCCCCCAAGGACTGGCCAATGGTGACCCTCATAGCTGAGGATGATCGGCACTATAACATCCCTGTCAGAGTGTGTGAGGAGACCAGTGTGTGAGGGACACACATGTGACTGCCAAGAGATGCGCATGTGCAGCTCCTCCTCTGGGGGCCTCAGATCTGCAGGTCTCCAAGGACAATCTGGGAGAACTCTCGGGCCCCTGGAGCCAACTTTGGACCATTATGTTCTGAAGACTAGCTGTTGATAATGAGAATTAATTAGCCAAGCCTTCACTCCTTGTTCTGTTATGCAGTGTGTTCCACTGGGGGCTTCAGCACGTGCCTTTGGAAGGTGCAAACTATGTCTCCATAAGGCGGATGCTTTTGGGTCAAAGAAAACTGTTTGGAAAGGAATCTGTCCAATGAAAGTTCTGACGGTA