Transcript asmbl_18047

Sequence
Transcript Sequence for observation asmbl_18047 of TGE0032183:
CCGAGCAGGAAGCGAGCCCGGCAGCCGCACTTTCCTGGGGAAGCGGCGGGCGGGACGGCCAGCGGGGCCAGGAGCTGAGGCCGCCGCTTGGATGGGGTATTGACAAATCTCCCAGGACTTTGGAAGGCTGAATGGACTAAACATGAAGAGCCTGAAAGCAAAGTTTCGGAAGAGCGATACAAACGAGTGGAACAAGAATGATGACCGTCTGCTGCAGGCTGTGGAGAACGGAGATGCTGAGAAGGTGGCCTCACTGCTGGGCAAGAAAGGGGCCAGCGCCACGAAGCATGACAGCGAGGGCAAGACCGCTTTCCACCTTGCCGCTGCGAAGGGACACGTGGAATGCCTCAAGGTCATGGTGACACACGGTGTGGATGTGACTGCCCAAGATTCTTCCGGTCACAGTGCTTTGCATGTCGCAGCCAAGAATGGCCACCCAGAGTGCATCAGGAAGCTTCTTCAGTACAAGAGCCCAGCGGAGAACATTGACAACTCGGGGAAAACAGCTTTGCATTATGCAGCGGCACAGGGATGCCTTCAGGCTGTACAGCTCCTCTGCGAACACAAGAGCCCCATAAACCTTAAAGACTTGGATGGGAACATCCCCCTGCTTGTTGCAGTCCAGAACGGCCACAGTGAGGCCTGCCACTTTCTCCTGGATCACGGCGCAGATGTCAATTCCAGAGACAAAAATGGAAGAACTGCTCTCATGCTGGCTTGTGAAACCGGCAGCTCGAACACTGTGGACGCCTTAATTAAAAAGGGAGCGGACCTGAGCCTTGTCGATTCTCTCGGACACAATGCCTTACATTATTCCAAACTCTCGGAAAATGCAGGAATTCAAAACCTTCTATTATCAAAAATCTCTCAGGATGCTGATTTAAAGACTCCAACAAAACCAAAGCAGGCTGAGATCAGCTCCATACAAGAAAACAAAGACAGGCTGAGCGACAGTACTGCAGGTGCTGACAGCTTGTTGGATATAAGTTCTGAAGCTGACCAACAAGATCTTCTTGTCCTGTTGCAAGCAAAAGTCGCTTCCCTTACCTTACACAATAAGGAGTTACAAGATAAATTGCAGGCCAAATCGCCCAAGGACAAGGAAGCGGAAGCCGACCTAAGCTTTCAGTCTTTCCATTCGACCCAGACTGACCTGGCCCCATCCCCGGGCAAAGCTAGTGACATCCCTTCCTCCGATGCCAAATCATCCCCACCCGTTGAGCATCCGGCGGGGACGTCCACCACTGACAATGATGTCATAATCCGGCAGCTCCAAGATTCCCTGCATGATCTGCAGAAGAGATTGGAGAGCTCCGAAGCAGAGAAGAAACAGCTCCAGGACGAACTCCAGTCACAAAGGACAGACACGCTTTGCTTGAACAACACAGAGATCTCCGAGAATGGCTCTGACCTCAGTCAGAAGCTCAAGGAAACCCAGAGCAAGTACGAAGAGGCCATGAAAGAAGTCCTGAGCGTGCAGAAACAGATGAAGCTGGGTCTCCTCTCCCAGGAGAGCGCCGATGGCTACTCGCATCTCCGGGAGGCGCCAGCTGACGAAGACATCGACACACTAAAGCAAGACCTGCAGAAAGCGGTGGAAGAAAGTGCAAGGAACAAGGAGCGGGTGCGGGAGTTAGAGACTAAGCTTGCGGAGAAGGAGCAGGCCGAAGCGACTAAGCCACCTGCCGAGGCGTGTGAGGAGCTGAGAAGTTCCTACTGCTCTGTTATCGAGAATATGAATAAGGAGAAGGCATTTTTGTTTGAGAAATATCAACAGGCCCAAGAAGAGATCATGAAACTGAAGGACACGCTAAAAAGTCAGATGCCACAGGAAGCCCCCGACGACTCTGGGGATATGAAAGAGGCCATGAACAGGATGATTGATGAACTCAATAAACAGGTGAGCGAGCTGTCACAGCTGTACCGAGAAGCCCAGGCAGAGCTGGAGGATTACAGGAAGAGGAAATCTCTGGAAGATGCAGCCGAGTACATTCACAAAGCTGAACACGAGAGGCTGATGCACGTGTCAAACCTGTCCAGGGCCAAGTCGGAAGAAGCGCTGTCGGAGATGAAGTCTCAGTATTCCAAAGTGTTGAACGAGTTGACTCAGCTCAAACAGCTGGTGGATGCACACAAAGAGAACTCCGTGTCCATCACAGAGCATTTGCAAGTGATAACCACGCTGCGGACAACGGCCAAAGAGATGGAAGAAAAGATAAGCGCCCTCACAGGGCACCTTGCAAACAAGGAAGCGGAAGTGGCAAAGCTGGAGAAGCAGCTCGCCGAAGAGAAGGCTGCCGTGAGCGACGCGATGGTCCCCAAGTCTTCCTACGAGAAGCTCCAGGCCTCCTTGGAGAGCGAAGTCAATGCCTTAGCAACAAAGTTAAAGGAGTCAGTAAGAGAGAGAGAGAAAGCCCATTCCGAGGTGGCCCAGGTTCGAAGTGAGGTCTCACAGGCGAGAAGGGAAAAGGACAACATCCAGACTCTCTTGAAAGCCAAAGAGCAGGAAGTAACTGCGCTTGTGCAGAAGTTCCAGCGAGCTCAGGAAGAACTGGCTGGGATGCGAAGATGCTCTGAGACCTCGTCGAAGCTGGAGGAGGATAAAGATGAAAAGATAAATGAAATGACCAGGGAAGTCCTGAAGCTGAAGGAGGCCCTGAACAGCCTCTCGCAGCTCTCCTACTCCACAAGTTCATCCAAGAGGCAGAGCCAGCAACTGGACCTGCTACAGCAGCAGGTCAAGCAGCTGCAGAACCAGCTGGCTGAATGTAAGAAACACCACCAGGAGGTCATCTCAGTTTACAGAATGCATCTTCTATATGCCGTTCAGGGCCAAATGGATGAAGATGTCCAGAAGGTCTTGAAGCAGATCCTCACCATGTGTAAAAACCAGTCTCAGAAGAAGTAAAAATGGATTCTTTGGCAGGACACTTGCCCCTCGTTGCCTCTCTTTGTGTTAGATCTGGGGTTGTCACTGACCACTGCCATTGTTCTTATCCATAGTGTGCACTGTGACCCATCGTAGCATCTTTTCCAGAGGTTTCTGAGGGCTAGTCCCAAGAGAAGATACCCTCTTCAGAACTGCATAGGTACTCCAGACCAGCAGAGGTGAAAGACCCTGCTATCTCTTCAGAATCTAGCACTGGGATTGGCACCATCCCGGTGGCTTTATGGAGTGATGTGCTGAAGCCACCATGCAGTGAGTGGTCCTTGATCCCTGCCTTTGGGATGTGCCATTCAGCACAGGAGAGCATTTTGCCTTCCATTCCCCAAATATGATTTAATTCCTAACCAAACTAAAATGACACTAGAAGTGAATGCTTAAGACCCTTTCTCCTGTGGATTTAAAAACTCTACTCTGTCCCCCCAGCTGCCTTAAATCTCATCCCCTTGCTTGTGGTCTCATCATTTGATGAGTATCATTAACTAAAGTACAACGTTTTAAGCCAAGAGTGAAGTCTCCTTAAAAGTTTTCAGTAAGTCAACATACTGTAAATTTTCTATGCAAACTTGCCTAGAAAACTTTCCACAATGCTCAGGAAGTCCAGATATTTGTATTTCAACAAAGGACAGTAAACTATGTGTTTACAGCCAAAAGACATGCCTCATAGTTCTTAACCTCAATTTTTTAAAAGTGTTTTTTTTCCTCTATGATATTTTTATTGGCTTTTAAAGATGTTTTCATAGCTAAAGCCCTAAGTAAGTGAGATTAGATTATATTAACATTATTTTTAGATAAACATACTTAAGACTTCTCAAAAATGTAACTTTTTCCTCAAAAGTTTTCAGAGGGTAGTTATATATTCCAAACTCAGTATGAGCTGCCACCAGAACCACTAGGAATTTCTGTAGTCTACTTCTGAATGCAGTAAATACTCCTTTTGCCCGTTGAACTTGTAAACACCTCAAACTCTAGCACCCACGAATGATTCCTGAAAGGGCTGTCAGTTCCAGTCAGCTTCTCCATGTTGAAAGTAAAAGTTCCAACATGGCACCGCGGTGCATAGCAGAAACCTCGGGGGAAATACGCCTACCGACCTTACTTTCAGGTTGAAAAGGTTCAACTTGCTTGCAGCTTCTCTTACAGCCCCCATGGTGAGGGAGATAAATGAAATAAAGGAACTTTGGGTGTGTTACTAAAGGTAGCGGTCTACTCTGACAGGACCCATCTGAGGCCACGTGGCTGAGTTGGGTCTGTTCATCTGTCTTAGGTAACGATCAATACCAGCATGAATTGGGTCTGTTCATCTGTCTTAGGTAATGATCAATACCAGCA