Transcript asmbl_16661

Sequence
Transcript Sequence for observation asmbl_16661 of TGE0032146:
CTGGCCCCGCCTCCTCGCCCTGCCCACTCCCCGGCGTCTAAACACAGGTGGGAGCGGGAGATCCCGACAGGTGAGCCCCGCGCCCAGCAGTCGCAAGGATGGAGTTCGTCAAGTGTCTAGGCCACCCGGAGGAGTTCTATAACCTGCTGCGATTCCGCATGGGAGGCCGGCGGAATTTTATACCCAAGATGGACCAGGACTCACTCAGCAGCAGCTTGAAGACCTGCTACAAGTATCTCAATCAGACCAGTCGCAGCTTTGCCGCGGTTATCCAGGCGCTGGATGGGGACATACGGCACGCCATATGTGTGTTCTACCTGGTTCTCCGAGCCCTGGATACAGTGGAGGATGACATGAGCATCAGTGTGGAGAAGAAGATCCCACTGCTGTGTAACTTCCACACTTTCCTCTATGACCCAGAGTGGCGGTTCACTGAGAGCAAGGAGAAGGACCGACAAGTGCTGGAGGACTTCCCCACGATCTCCCTGGAGTTTAGAAATTTGGCTGAGAAATATCAAACAGTGATCGATGACATCTGCCACCGGATGGGGTGTGGGATGGCAGAATTTGTAGACAAGGATGTGACCTCCAAACAGGACTGGGACAAGTACTGCCACTACGTTGCTGGGCTGGTGGGAATTGGCCTTTCTCGTCTATTCTCTGCCTCAGAGTTTGAAGACCCCATAGTTGGTGAAGACATAGAGTGTGCCAACTCAATGGGTCTGTTCCTGCAGAAAACAAATATCATTCGTGATTATCTGGAAGACCAACAGGAAGGAAGGAAGTTTTGGCCTCAGGAGGTGTGGGGCAGATACATTAAGAAGTTGGAAGACTTTGCTAAGCCAGAGAACGTAGATGTGGCCGTGCAGTGCTTGAATGAACTCATAACCAACACCCTACAGCACATCCCTGACGTCCTCACCTACCTGTCAAGGCTCCGGAACCAGAGTGTGTTTAACTTCTGTGCTATTCCACAGGTAATGGCCATTGCCACACTGGCTGCCTGTTACAATAACCAGCAGGTATTCAAAGGAGTAGTGAAGATTCGGAAGGGGCAAGCAGTCACCCTCATGATGGATGCCACCAACATGCCTGCCGTCAAAGCTATCATATACCAGTACATAGAAGAGATTTATCACCGGATCCCCAACTCAGACCCATCATCAAGCAAAACCAAGCAGGTCATCTCCAAGATCAGGACACAGAACCTTCCCAACTGCCAGCTCATCTCCCGAAGCCACTACTCCCCCATTTACCTGTCATTTATCATGCTCTTGGCTGCCCTGAGCTGGCAGTACCTGAGCACCCTGTCCCAGGTCACAGAAGACTATGTCCAGAGAGAACACTGATTTTGTTTAGCCGGAAGTGGAAGTTCCCGTGGAGTGGGTTTTTCCTTTTCCTCCAGCTGGATTTTGACTTCCCTTGTTTTTCCTCCTACTCTAAAATCTTTGGGAGAACTGAGTGTGGGACCTTTAGGAACTGGGCAGAGGAAAGGATGCCTTGCCCTCAGCAGCCTGGTGCTGGCTGGGACTTGGTTCCTCTGCCTCTTGTAGCCACTGGCAGCGTGCCGACTGCTGCACTTGTGAGGCCACGTGTGATGGTCACAAGAGCCTAGTGAACCTGGCTAGAATGCTGATTGGATTTATTTAATTTGAAACAGCCTTTGAATACCTATGACAATAGAAAATGAAAGCAA