Transcript asmbl_16599

Sequence
Transcript Sequence for observation asmbl_16599 of TGE0032142:
CAAAGTCCGGGGGAGCGACCTGGGAAGCGGAATTCGGGGCCTGAACCTCCGTGCCTTGACCTACTGATTGTTCCCTTTGCAGACCCTGCCTTCCTCTCAGTCCACACTCCGAGCCGTAGACGTCGGGTTTCCAGCTCCGTCTGTGCACACATAACTCCAGGAAGCCGCTAGCTCCCGACGATGTCTTCTGTCAAGTTATGGCCTACTGGTGCGTCAGCGGTTCCTCTGGTGAGCCGTGAAGAACTGAAGAAGCTGGAGTTTGTGGGTAAAGGAGGGTTCGGAGTCGTGTTCCGGGCACACCACAGAACATGGAACCATGATGTAGCAGTCAAGATCGTGAACTCGAAGAAGATATCCTGGGAGGTGAAGGCTATGGTTAATCTTCGTAATGAGAACGTTCTGCTCCTGCTGGGGGTCACTGAGGACCTCCAGTGGGACTTCGTGTCCGGGCAGGCTCTGGTGACAAGATTCATGGAGAATGGCTCCCTCGCAGGGCTGCTGCAACCCGAGTGCCCTCGGCCCTGGCCACTCCTCTGTCGCCTGCTGCAGGAAGTGGTGCTGGGGATGTGCTACCTACACAGCTTGAACCCTCCGCTCCTGCACCGGGACCTCAAGCCCTCTAACATTCTGCTGGATCCAGAGCTCCACGCCAAGCTAGCAGATTTTGGCCTGTCCACGTTTCAGGGAGGGTCCCAGTCAGGGTCAGGATCAGGATCAGGATCCAGGGACTCTGGGGGCACCCTAGCGTACTTGGACCCAGAGCTGTTATTTGATGTCAACCTGAAGGCTTCTAAAGCGAGTGATGTCTACAGCTTTGGGATCCTCGTGTGGGCAGTGCTGGCTGGCAGAGAAGCTGAGTTGGTAGACAAGACTTCACTAATCCGGGAAACAGTGTGTGACAGGCAGAGTCGTCCTCCACTGACAGAGCTGCCTCCAGGTAGCCCTGAGACTCCCGGCTTGGAAAAACTGAAGGAGTTAATGATTCATTGCTGGGGTTCCCAGTCCGAAAACAGGCCATCCTTCCAGGACTGCGAACCAAAAACCAATGAAGTTTACAATCTGGTAAAGGACAAGGTAGATGCTGCTGTCTCCGAGGTAAAGCATTATCTGTCTCAGCACAGAAGCAGCGGCAGAAACTTGTCTGCCAGAGAGCCAAGCCAAAGAGGCACAGAAATGGATTGCCCGAGGGAAACCATGGTTTCTAAAATGCTGGACCGCCTGCATTTGGAGGAACCCTCCGGACCAGTTCCTGGAAAATGTCCTGAGAGGCAAGCACAGGACACATCAGTTGGGCCTGCCACACCAGCAAGGACATCTTCTGACCCCGTGGCTGGCACTCCTCAGATTCCACATACTTTACCCTTCAGAGGCACAACACCTGGGCCAGTCTTTACTGAGACTCCCGGTCCTCACCCCCAAAGGAATCAGGGAGATGGAAGACACGGCACTCCTTGGTATCCCTGGACCCCACCGAATCCAATGACAGGGCCACCGGCTCTCGTCTTCAACAACTGTTCTGAAGTGCAGATTGGGAACTACAACTCCTTGGTAGCACCACCAAGAACTACTGCCTCAAGTTCGGCCAAGTATGACCAAGCACAGTTCGGCAGGGGTAGGGGCTGGCAGCCCTTCCACAAGTAGACTTCAGAGAATCACTGCAAGAGCCTGAAGTGTGCCATTCAGCGTGGCAATAAAAAGCACGTTTTAAGCAACCTGGACTGGCTAAGACAGTCCTTGCCACTTCCTGAAGCTCACAACATTCTGTGAGGACAGTTGGACCTACACCCAAACTGACTCTTGACCCATCTCCTTAAAGTCAATAAACATAGCATGTTAACTGTGA