Transcript asmbl_69570

Sequence
Transcript Sequence for observation asmbl_69570 of TGE0007406:
CGGTCCTCCTTGCGGTGGACGGGTCTGCCTGCCCAGATCCGCCGCCCAGCGAGGATCCAAGGCATCTGTGCGGCCCGGGGGGCTCGGCCGGGACAAGCTAGGGGCACGGTGCCCGGGGCGGGTGGGCGGTGACCCGACGCAGGGCAAGCGGAAGAATAGATTCGCGGACCTCCGAGGGGAACCTGAGAGTGCAGACCTTGAGCGGACGTGAAACCGGCGCGGTCCGGGGGCCGGGAACTGCTCAGCGCTGCAGGGCTCCACGGCGCTGCCCGCCCGCGCGTTTCCAGGGGCGCGGGGAGCAGGTGAACAGGTCCTCGCTCACAGCTCCACGCCCTCACGCGCTCTCGCCCCGGCCTCCGCTCCCGCTTGCAGCCATGGGCCCGGGTCTCCGCCTCGCCACCCGCGTCCCACGCCAGATGCTTTGCGCGCTGGCCTTGATGGTGGCCGCTGGCGGCCGCATTGCCTCTGCTTTCAACCTGGACACCCAATTCCTGGTGGTGAAGGAGGCCAGGAACCCGGGCAGCCTCTTCGGCTACTCGGTCGCCCTCCATCGGCAGACGGAGCGGCGGCGGCGCTACCTGCTCCTGGCTGGTGCCCCCCGGGATCTTGCTGTGCCTGATGGCTATACCAACCGGACTGGTGCTGTGTACCTGTGCCCACTCACTGCCAACAAGGACGACTGTGAGCGGATGGACATCGGAGAGAAAAGTGACCCTGACCATCACATAATTGAGGACATGTGGCTGGGGGTGACTGTGGCCAGCCAGGGCCCTGCAGGCAGAGTCCTGGTCTGTGCCCACCGCTACACCCAGGTGCTGTGGTCGGGGCTGGAGGACCAGCGGCGCATGGTGGGCAAGTGCTATGTGCGGGGCAATGACCTAGAGCTGGACCGCACTGATGACTGGCAGACCTACCACAACGAGATGTGCAACAGCAACACTGACTACCTGGAGACGGGCATGTGTCAGCTGGGCACCAGTGGCGGCTTTACCAAGAACACTGTGTACTTCGGTGCTCCCGGTGCCTACAATTGGAAAGGAAACAGTTACATGATTCAGCGGAAGGACTGGGATTTATCTGAATACAGTTACAAGGGCCCAGAGGACCAAGGAAACCTCTATATTGGGTACACAGTGCAGGTGGGCAGTGCCATCCTGCACCCCACGGATATCACCATTGTGACAGGTGCCCCACGGCACCAACATATGGGCGCTGTCTTCTTGCTGAGCCAGGAGGTAGGCGGAGACCTGCGGAGGAGGCAGGTGCTGGAGGGCACACAGGTGGGCGCCTATTTTGGCGGTGCCATTGCCCTGGCAGACCTGAACAATGATGGGTGGCAGGATCTCCTGGTGGGTGCCCCCTACTACTTTGAGCGGAAAAAGGAGGTAGGGGGTGCCATCTATGTCTTCATGAACCAGGCAGGCACCTCCTTCCCTGCCCACCCCTCCCTCCTTCTTCACGGTCCTAGTCACTCTGCCTTTGGCTTCTCCGTGGCCAGCATTGGTGACATCAACCAGGATGGATTCCAGGACATTGCTGTGGGAGCTCCATTTGAAGGCTTGGGAACAGTGTACATCTATCACAGCAGCTCCAGGGGGCTTCTCCAACAGCCCCAACAGATAATCCACGGAGAGAAGTTGAGACTACCTGGCTTGGCCACCTTTGGCTACTCCCTGAGTGGGCGGATGGATGTGGATGAGAACTCCTACCCGGACCTGCTAGTGGGGAGCCTTTCAGACCGCATCGTGCTCCTGAGGGCGCGGCCTGTCATCAACATCCTCTATAAGACCTTGGTGGCCAGGCCTTCGGTGCTGGACCCCACACTCTGCACAGACACCTCTTGTGTGCAGGTGGAGCTGTGCTTTGCTTATAACCAGAGTGCTGGGAACCCCAACTACAGGCAAAATATCACCCTGGCCTATACACTGGAGGCTGACCGGGACCGCCGCCCACCCCGACTTCGCTTTGCACAGAGCCAGTCAGCTGTCTTTCATGGCTTCTTCTCCATGCCCGAGATGCGCTGCCAGACGTTGGAGCTGCTCCTGATGGACAACGTCCGTGACAAACTCCGTCCCATCGTCATCTCCATGAACTACTCTTTATCTTTGCGTATGCCGGAGCGCCCCAGGCTGGCGCTGCAGTCCCTGGACGCCTACCCGGTCCTCAACCAGGCGCAGGCTCTGGAAAACCACACTGAGGTCCAGTTCCAGAAGGAGTGTGGGCCGGACAACAAGTGCGACAGCAACTTGGAGATGCAGGCAGCCTTCGTGTCCGAGCAGGGGCAGCCGATGAGCAGGCTCCAGTACAGCAGAGACTTTGGGAAACTGCTCTTGAGCATCAATGTGACTAATATCCGGAGCAGGCAGCGGGCTGGAGAAGATGCCCACGAGGCGCAGCTCACCCTGGCGGTACCTCCCGCCCTGCTACCGTCCTCAGTGCGCCCTTTTGGGGCCTGCCAGGGCAACGAGACTATCCTTTGCCACCTGGGGAACCCCTTCAAACGGAACCAGCGGATGGAGCTACTCATCGTCTTTGAGGTCATCGGGGTGACCCTGCACACAAGGGAGCTCCAGGTGCAGCTGCAGCTGTCCACGTCAAGTCACCAGGACAATCTGCAGCCCATGACCCTGACTCTACTGGTGGATTACATGCTCCAGGCCTCACTCAGCATGGTGAGTCACCGGCTACAAAGCTACTTTGGGGGAACAGTGATGGGTGAGTCTGGCATGAAAACTGTGGAGGATGTGGGGAGCCCTCTCAAGTATGAGTTCCAGGTGAGCCCAATGGGGGAAGGGCTGGCAGCCCTGGGCACCCTGGTCCTAGGACTGGAGTGGCCCTACGAAGTCATCAATGGCAAGTGGCTGCTGTACCCTACAGAGATCACCATCCGCGGCAATGGGTCCTGGCCCTGCCAGCCACCCGGAGACCTTGTCAACCCTCTCAACCTCACTCTCTCTGTCCCTGGGGATAGGCTGCCAACTTCACAGCGTAGGCGAAGACAGCTTGACCCAGGGGGAGGCCAGGGCCCCCCACCTGCTACTCTGGCTGCTGCCAAAAAAGCCAAGTCTGAGACCCTGCTGAGCTGTGGCAGTGACCACACCCGCTGCGTGTGGCTGGAGTGCCCTATTCCTGATGCCCCTGTCATCACCAATGTGACTGTGCAGGCTCGAGTGTGGAACAGCACCTTTATTGAGGATTACAGGGACTTTGACCGAGTCAGGGTAACCAGCTGGGCTACCCTGTTCCTCCGAACCAGCATCCCCACCATTAACATGGAGAACAAGACCGTGCCGTTCTCTGTGGACATTGACTCTGAGCTGGTGGAGGAGCTTCCAGCTGAGATCGAGCTGTGGTTGGTGCTCGTGGCTGTAGGTGCCGGGCTGCTGCTGCTGGGGCTCATCATCCTCCTGCTATGGAAGTGCGGCTTCTTCAAGCGAGCCCGCACTCGCGCCCTGTATGAAGCCAAGAGACAGAAGGCGGAGATGAAGAGCCAGCCGTCAGAAACAGAGAGGCTGACCGAAGACTACTGAAGGGGGCGGCCCCTGCCCCCAACCCACCCGGTGTGACTTCTTTAAACGGACCCACTATTACCAGATCATGCCTAAGTACCACGCGGTGCGGATCCGGGAGGAGGAGCGCTACCCACCTCCAGGGGAGACCCTGCCCACGAAGAAGCACTGGGTGACCAGCTGGCACACTCGGGACCGATACTACTGACATCCTCCCTGATCCCACCCCCGTGCCCCCAGTGTCCCCTTCTATTTATCATAAGTTATGCCCTGACAGTCCACAGGGGCCACTGCCTTTGGCTGGCGCCAGCAGGCTCAGGCACACACACCTCTTCGAGCGCATACATGTGTCGTCTGGCCACAGACTTCTCCGCGCAGGAGTGCTGGGACCGTGGACCTTGCTCTGCCAAGCACACCACAGACCTGTGCCCTGGACACATGTGGATACATGTGGGTCCCACTGTGCTTGTGCACCACAGATGGTTTATGGACATGTGTGTCCCAGCCTCTGCTAGAGCCAGGAGGAAAAGGCTCCCAATGTGGTGACACCTTTCTTGTTCACACTGGACCCATCTTGAGCCATAGTCACTGGATGGACTCTGCTCTCAAGATTAAAACTACTGACAGGGAACAGCCCACCAGGCTGTACCTCAAGCTGTAGTTCCTGGCACCCATGCCAGAGAGCGTGAGGTCTGCCTGAGGTTGTCTAAGGGGGTGTTTGTAGGACCCAGCATGCTCAGACACAGAGCAGAATGAACTAAAATGAGGGTCCCCAGGATGACTTTCTTTCATGGATCTCTGTGAAGCCTCTCTCCTCAGCCACAGCATGTCCTAGCAGGGAATGCGGCCTAAAGGAACAAAGATAGACATCCTGGCATGCTGTGCGGGGACTGCCCTGGGAGCACAGTGGAATCCTCAACAGAGGAGGGGACCGGCCCTGGGCCAAGGAGATGTTGGAAGGATACATAAGAAATACCACTTCTCACCCATCACTACCATCCCGGCCTCTGAAGGGCCTGGAGAATTCCCACAAGATCACAGAGGGAGCGACACTTGAATGTAGGACAGGGAGGAAGCCCTGTCCCTGTCCCATTGGCCAGACCCCACTCTGCCCCCACTGACCAAGGGTTAGGGGCCAAGAAGTGGAGTTCTTGGCTGTCCTTGGCTTTCATCACCTATCGGCTCTGCCTTCTCCCCCATGGGCTGAGTCCTGAGGCCCATTCTAGAAGTCGAAGCTGGTTCCAAAAACCCTCTCCTGCCCCCTGCCTGTTGGCAGCTCCCCTTACCCCCTTCCACGGTACTGTAGTAGGGGAGCTCCCTCTCCCTCCTTGTGCCTTCTTTGTATATAGGCTTCTCACATCAACTAATAAACAGCTCCCTGTTTGT