Transcript asmbl_164

Sequence
Transcript Sequence for observation asmbl_164 of TGE0032015:
GCACTTTCTAGGCTTTTCCAGGCCGGCCGCCGAGGTGAAAGAACGAGCCCCCCTCCCGGAAATGACGCCACTTGACCTTTCACCCACGGGACGCGCGGGGCCTTCCGGAAGGTTCTAGAACGGACCGTGGCCCAGGAACCAGCGTAGGGCGGCGGGAGAGGGCTGAGGCCGCAGAGCTGAGGCGGCTCTGAAATGCTTCGACTACCCACAGTCCTTCGCCAGATGAGACCAGTGTCCCGGGCACTGGCTCCTCATCTCACTCGGGCCTATGCCAAAGATGTAAAATTTGGTGCGGACGCTCGAGCCTTAATGCTTCAAGGTGTAGACCTTTTAGCAGATGCTGTAGCTGTTACAATGGGGCCAAAGGGAAGAACTGTGATTATTGAACAGAGTTGGGGAAGTCCCAAAGTAACAAAAGATGGGGTCACTGTTGCAAAGTCAATTGATTTAAAGGATAAATACAAAAATATTGGAGCTAAACTTGTTCAGGACGTTGCCAATAACACAAACGAAGAGGCTGGGGATGGCACCACCACTGCCACTGTTCTGGCACGATCTATTGCCAAGGAGGGCTTTGAGAAGATCAGCAAAGGGGCTAATCCAGTGGAAATCCGGAGAGGTGTGATGTTGGCTGTGGATGCTGTAATTGCTGAACTTAAGAAACAGTCTAAACCTGTGACAACCCCTGAAGAAATTGCTCAGGTTGCTACAATTTCTGCAAATGGAGACAAAGACATTGGGAACATCATTTCTGATGCAATGAAAAAGGTTGGAAGAAAGGGTGTCATCACAGTGAAGGATGGAAAAACCCTGAATGATGAGCTAGAAATTATTGAAGGCATGAAGTTTGATAGAGGATATATTTCCCCGTATTTTATTAACACATCAAAAGGTCAAAAGTGTGAATTCCAAGATGCCTATGTCTTGTTGAGTGAAAAGAAAATTTCCAGTGTTCAGTCCATTGTCCCTGCTCTTGAAATTGCTAATGCTCATCGGAAGCCATTGGTCATAATCGCCGAAGACGTTGACGGAGAAGCTCTAAGCACGCTGGTTTTGAACAGGCTAAAAGTTGGTCTTCAGGTTGTGGCAGTCAAAGCTCCAGGATTTGGGGACAATAGGAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAGAGGGGTTGAATCTAAATCTTGAAGATGTTCAAGCTCATGACTTAGGAAAAGTTGGGGAGGTCATTGTCACCAAAGATGATGCCATGCTTTTGAAAGGAAAAGGTGACAAAGCTCACATTGAAAAACGTATTCAAGAAATCACTGAGCAGCTAGACATCACAACTAGTGAATATGAAAAAGAAAAGCTGAACGAGCGACTTGCTAAACTTTCAGATGGAGTAGCTGTGTTGAAGGTTGGAGGAACAAGTGATGTTGAAGTGAATGAGAAAAAAGACAGAGTTACTGATGCTCTCAATGCTACAAGAGCAGCTGTTGAAGAAGGCATTGTTCTAGGAGGGGGCTGCGCTCTGCTTCGGTGCATCCCAGCCTTGGATTCATTAAAGCCTGCTAATGAAGACCAGAAAATAGGTATAGAAATTATTAAAAGAGCACTTAAAATTCCTGCAATGACGATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATAGTTGAGAAAATTCTGCAGAGTTCCTCAGAAGTTGGTTATGACGCCATGCTTGGAGATTTTGTGAACATGGTGGAAAAAGGGATCATTGATCCAACAAAGGTTGTGAGAACTGCCTTACTGGATGCTGCTGGGGTGGCCTCCTTGCTAACTACAGCCGAAGCTGTAGTGACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCAATGGGTGGCATGGGAGGGGGTATGGGAGGCGGCATGTTCTAACTCCTAGAGTAGTGCTTTGCCCTTATCAATGAACTGTGACAGGAAGCTCAAGGCAGGTTCCTCACCAATAACTTCAGAGAAGTCACCTGGAGAAAATGACTGAAGAGAAGGCTGGCTGACCACTGTAATCATCAGTTACTGGTTTCCTTTGACGATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAGACATTTGTACATTCCTGATGCTGGGTGCAAGAGCCATATACCAGTGTCCTGCTTTCAACTTAAATCACTGAGGCATCTCTACTGTTCTGTGAGCATCAGGACTGTAGCGCTGTGTCACCACATGAGAGTTCAGAAGCAGCCTTTCTGTGGAGGGTGGGAATGATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAATTTTGTTTAAAGTT