Transcript asmbl_16335

Sequence
Transcript Sequence for observation asmbl_16335 of TGE0032086:
CTTCCATCAAGTGGTGGCCTGGGGACTTGGGACGGACAGTCACCCATGCTGTGGTCCTAGCCCATTTGATCTGCTTAGGAGCCCGGCATGGCATGCATGCCTTCATTGTGCCCATCCGGAGCCTAGAGGACCACACCCCACTGCCAGGAATAACAGTTGGGGACATAGGCCCCAAGATGGGCTTCGAAAACATAGACAATGGCTTCCTGCGACTGAACCACGTGAGGGTTCCCAGAGAGAACATGCTCAGTCGCTTTGCAGAGGTCTTGCCAGATGGCACCTACCAGAGGCTTGGGACACCACAGAGCAATTATCTTGGCATGTTGGTGACACGGGTGCAGCTGCTGTATAAAGGATTCCTACCCACCCTCCAGAAGGCTTGCACCATTGCTGTGCGCTACGCAGTAATCCGCCACCAGTCTCGTCTTCGGCCTAGTGACCCAGAGGCAAAAATCCTGGAATACCAGACACAGCAGCAGAAACTCCTGCCTCAGCTTGCTGTGAGCTATGCCTTGCATTTCATGACCACCAGCCTCTTACAATTCTTCCACAGCTCCTACAGTGATATTCTGAAGAGAGACTTCAGCCTCCTGCCTGAGCTCCATGCACTGAGCACTGGCATGAAGGCCATGTCTTCAGACTTCTGTGCCCAGGGAACAGAGATCTGCCGCAGGGCCTGCGGGGGTCATGGCTACTCAAAGCTGAGCGGCCTACCGACACTGGTCACTCAAGCGATAGCCTCTTGCACGTATGAGGGTGAGAATACGGTGCTCTACCTGCAAGTGGCCAGGTTTCTGATGAAGAGCTACCTGCAGGCTCAAGTGTCCCCAGGATCCATACCACAGAAGCCTCTCCCTCAGTCCGTCATGTATCTCGCCACACCAAGACCAGCCAGGTGCCCAGCCCAGACAGCAGCTGACTTCCGCTGCCCAGAAGTCTATACCACAGCCTGGGCATATGTGTCTGCCAGGCTCATAAGAGATGCAACACAGCATACACAGACCCTCATGAGATCCGGGGTTGACCAGTACGATGCTTGGAACCAGACTTCTGTCATACACCTTCAGGCTGCTAAGGCTCACTGCTACTTCCTCACTGTGAGGAATTTCAAGGAAGCTGTGGAGAAACTAGACAACGAACCAGAGATTCAGCGTGTGCTTCAGAACCTCTGTGACCTCTATGCCTTAAACGGTATTCTGACTAACTCAGGGGACTTTCTGCATGATGGCTTCCTGTCTGGGGCCCAAGTGGACATGGCAAGAACAGCCTTCCTAGACCTGCTTCCCTTGATCCGGAAGGACGCCATCTTGTTAACAGATGCTTTTGACTTCTCGGACCATTGTTTAAACTCTGCACTTGGCTGTTATGACGGACACGTCTACCAACGCCTGTTTGAGTGGGCTCAGAAGTCCCCAGCCAATACTCAGGAGAACCCTGCCTATAAGAAGTATATTAGACCACTGATGCAAAGCTGGAAACCCAAGCTGTGAAAAGCCAAAGGATTCAGGACCAAGCAGCACCATGGCCTTCCTATGGCACATATGCATATAAAGAATTTAAAGCACGGGGTGGCGTGCGGCTTGTTCAGATCAGCGAGTAAACTGGTACATGAAAGGATGTTCATCATATTATTCTGCTACTGAGTACATCTGAAACTTTCCCTTGTCTGTTTGTAGTACGTATTTGGCTAAATGCTAGAATTTTGCTTTAAAT