Transcript asmbl_15483

Sequence
Transcript Sequence for observation asmbl_15483 of TGE0050691:
CAGAGGCAGTGCTCGGGGCGGAAGCCCCAACCTTCTTCCCTGGCGAGTTAGAAGCTGCCCCTCACCGAGGAGGAGAATGGCGCTCAAACAGATTTCCAGCAACAGGTGCTTTGGCGGGCTCCAGAAAGTTTTCGAACATAGCAGTGTTGAGCTGAAATGTAAAATGAGATTTGCTGTCTACCTACCACCCCAGGCCGAGAGTGGAAAGTGTCCAGCGCTTTACTGGCTGTCTGGTTTAACTTGCACAGAACAAAATTTCATATCAAAGTCTGGCTATCAGCAAGCTGCCTCAGAGCACGGCCTTGTGGTCATTGCCCCTGATACCAGCCCTCGTGGCTGCAATATCAAAGGAGAAGATGACAGCTGGGACTTCGGCACTGGTGCTGGGTTTTATGTGAATGCCACTGAAGATCCTTGGAAAGCTAACTACAGAATGTACTCTTACGTCACCGAGGAGCTTCCACAACTCATAAATGCCAATTTCCCAGTGGACCCACAGAGGATGTCTATTTTTGGTCACTCCATGGGAGGCCACGGAGCTCTGATTTGTGCTTTGAAAAATCCTGGAAAATACAGATCTGTGTCAGCATTTGCTCCAATTTGCAACCCTGTGCTGTGTTCTTGGGGCAAAAAAGCTTTTAGTGGATATTTGGGACCAGATGAAAGTAAATGGAAGGCATACGATGCGACCTGTCTCGTGAAGGCCTATTCGGGTTCCCAGATTGACATCCTAATCGATCAAGGAAAAGATGACGAGTTTCTTTCAAATGGGCAGTTACTCCCTGATAACTTCATAGCTGCCTGCACAGAGAAGAAAATCCCTGTTGTGTTTAGACTACAAGAGGGTTATGATCATAGCTACTACTTCATTGCAACTTTCATCGCTGACCACATCAGACACCATGCTAAGTACCTGAATGCATGAAAAGCCTCAGCCAAGAGAATCTCATCAGGAGGCCGGAAGGGAATCAACAGGAGTGCTGACTTCCTCGCAGAAGATCATGCTCCTGCAGCTGAATCGCTTTTCTGAATAAATATATCAAACTTTCTGGTTTAAA