Transcript asmbl_15162

Sequence
Transcript Sequence for observation asmbl_15162 of TGE0032032:
GGAAGTTGAGCCTGGGAGCCTTGACGTTAGGAACGAAGTCGAACCTGGATCTGGAGCCGGGTGAGATCAAATCGGGGATGCTCTCATAATGAATGTCAACCAGTCAGCTCCACCTGTTCCACCATATGGGCAGAACCAGCCCATCTACCCAGGGTATCATCAGTCGAGTTATGGTGGGCAACCAGGACCTGCAGCCCCTGCTACTCCCTATGGAGCCTACAATGGCCCAGTGCCAGGTTATCAGCAGGCACCTCCTCAAGGTGTGCCAAGAGCCCCACCTTCCTCAGGGGCACCTCCAGCCTCTGCAGCACAGGTCCCTTGTGGTCAGACTACATATGGCCAGTTTGGCCAAGGTGATATACAGAATGGGCCGAGTTCCACAGCTCAGATGCAAAGGGTCCCTGGTTCTCAGCAGTTTGGTCCTCCATTGGCCCCTGTGGTCAGCCAGCCAGCTGTGCTTCAGCCCTATGGCCCTCCCCCCACAAGTACACAGGTGACTGCACAGCTGGCCGGAATGCAGATCAGTGGTGCTGTGGCCCAGGCCCCTCCCCCTTCTGGGTTGGGCTATGGTCCACCAACATCATTGGCCTCAGCCTCAGGAAATTTCCCTAATTCTGGTCCATACGGCTCCTATCCTCAGAGCCAGGCTCCTCCCCTTAGCCAGGCTCAAGGTCATCCTGGAGTCCAGCCTCCCCTTCGATCTGCCCCACCTCTGGCTTCCAGCTTCACGTCCCCAGCTTCAGGTGGTCCTCAGATGCCTTCCATGACTGGACTACTCCCGCCTGGACAGGGCTTTGGGAGTCTTCCAGTGAACCAGGCTAACCACGTGTCCTCACCTCCTGCTCCTGCTCTGCCCCCGGGCACCCAGATGACTGGGCCCCCAGTACCACCGCCACCACCTATGCACTCCCCTCAGCAGCCTGGTTATCAGCTGCAGCAAAATGGTTCCTTTGGACCAGCTCGAGGCCCTCAACCTAATTATGAGAGCCCATACCCTGGAGCACCTACCTTTGGCAGTCAGCCTGGGCCTCCCCAGCCATTGCCTCCTAAGCGTCTGGACCCTGATGCCATCCCCAGCCCTATTCAGGTTATTGAAGATGATAGAAACAACCGGGGTTCAGAGCCATTTGTTACTGGTGTACGGGGACAGGTGCCACCTTTAGTCACCACCAATTTCCTGGTGAAAGACCAAGGGAATGCAAGTCCCCGCTACATTCGATGCACATCCTATAATATCCCTTGTACTTCTGACATGGCTAAACAGGCTCAGGTGCCTCTGGCCGCTGTCATTAAACCACTGGCAAGGCTGCCTCCAGAGGAGGCTTCACCGTATGTTGTGGATCATGGAGAATCTGGCCCCCTGCGCTGTAATCGCTGCAAAGCATACATGTGCCCTCTCATGACATTCATCGAGGGAGGGAGGCGCTTCCAGTGCTCCTTCTGCAGTTGTGTCAATGATGTTCCCCCCCAGTATTTTCAACATCTGGATCATACCGGCAAACGTGTGGATGCTTATGACCGTCCTGAGCTGTCTCTGGGATCTTATGAATTCTTGGCTACTGTAGATTACTGTAAGAACAATAAATTCCCTAGTCCTCCTGCCTTCATCTTTATGATTGATGTCTCCTACAATGCCATCAGAACTGGTCTTGTTCGGCTCCTCTGTGAGGAGCTCAAGTCACTCTTAGACTACCTACCTAGGGAGGGTGGAGCAGAAGAGTCAGCAATCCGAGTTGGCTTTGTCACCTATAATAAAGTGCTCCACTTCTACAATGTGAAAAGCTCCTTGGCTCAGCCACAGATGATGGTTGTATCTGATGTAGCTGACATGTTTGTGCCACTGCTGGATGGCTTCCTAGTCAATGTCAGTGAGTCTCGGGCTGTTATCACCAGCTTATTGGATCAGATTCCAGAAATGTTTGCAGATACAAGAGAGACAGAGACAGTGTTTGCTCCAGTTATCCAGGCCGGGATGGAAGCTCTGAAGGCTGCTGAGTGTGCAGGAAAGCTGTTTCTGTTCCACACATCCTTGCCCATTGCAGAGGCCCCAGGGAAGCTGAAGAATAGAGATGATAGGAAGTTGATCAACACAGACAAGGAGAAGACTCTGTTTCAGCCTCAGACAGGTACCTATCAGACTCTGGCCAAAGAGTGTGTGGCCCAAGGCTGCTGTGTGGACCTCTTCCTCTTCCCTAACCAATATGTCGATGTGGCCACACTCTCTGTTGTTCCCCAGCTCACTGGAGGCTCTGTCTACAAATATGCCTGCTTCCAGGTGGAAAATGACCAGGAACGGTTCTTGAGTGACCTGCGTCGGGATGTACAGAAGGTGGTTGGCTTTGATGCTGTTATGCGGGTTCGGACAAGTACTGGTATCCGTGCTGTAGATTTCTTTGGCGCTTTCTATATGAGCAATACAACAGATGTGGAGTTGGCTGGATTGGATGGAGACAAGACAGTGACTGTGGAATTCAAGCATGATGACCGGCTCAATGAAGAGAATGGAGCCCTACTGCAGTGTGCCCTGCTTTATACCAGCTGTGCAGGGCAGCGTCGGCTCCGCATCCACAACTTGGCCCTAAACTGCTGCACCCAGCTGGCTGATCTGTATCGAAACTGTGAGACTGACACGCTCATCAACTACATGGCCAAGTTTGCATACCGGGCTGTTCTGAATAGTCCTGTGAAGACTGTCCGTGACACTCTCATCACCCAGTGTGCCCAGATCCTGGCCTGTTATAGAAAGAACTGTGCCAGCCCTTCTTCTGCAGGACAGTTGATTCTTCCTGAGTGCATGAAGCTCCTCCCAGTTTACCTGAACTGTGTGTTGAAGAGTGATGTTCTGCAGCCTGGAGCTGAGGTCACTACTGATGATCGTGCCTATGTTCGGCAGCTGGTTTCCTCCATGGATGTGGCTGAGACCAATGTCTTCTTCTACCCTCGGCTCCTACCACTGACAAAGTCTCCCCTTGATAGTACCGCTGAACCACCAGCAGTTCGAGCCTCTGAAGAGCGCCTAAGCAGTGGCGATATATATTTGCTGGAAAATGGGCTCAACCTCTTTGTCTGGGTGGGAGCAAGCGTCCAACAAGGTGTTGTCCAGAGCCTTTTCAACGTGTCCTCCTTCAGTCAGATCACCAGCGGCTTGAGTGTTCTGCCAGTTCTGGATAATCCACTGTCTAAGAAAGTTCGAGGTCTCATCGATAGCTTACGGGCACAGAGAATGCGGTACATGAAGCTTATCGTGGTCAAGCAGGAAGACAAGCTGGAGATGCTGTTCAAGCACTTCCTGGTGGAAGACAAGAGCCTAAGTGGAGGTGCATCCTATGTGGACTTTCTCTGTCATATGCACAAGGAGATCCGGCAGCTACTGAGCTAAAGCAAGTGGGTAAATGGCATAGGGTCCCAGGCCAGCTTCCAGGAAGAACCCCAGGATGACAGAGAAATTGGGACAGTTCCATATCGTATAAGTCATGTAAGCTGACCTCAGTTGACTTCTTTTGGGGGGAGGGCGAGATATAAGGAGACACCGTCTTTCTGGGCTCAAATACACTACCACTCTGTCATGTCCTGCTGATCGAAGGTGCCTCAGGCCCCTTACTCTACCCTTTCTCCTGCTAATCCTCTTGTAATGAATGTAGTTTCTCAGTTCACTGTATATGATTCGGTGTTGGGGGTTTGGAGGCAGCTGGGCCCTGGCAACAGTGTGTCCCTTTGGATGAGCCTCCAAGAGGAAGGGCAGGCAGGAAGAAGTGGGAATCCCAGGGTTATTACAGGAGGTGGCAAATTCAGCTCCGTGTCATCAACAACTTCCTATATTAGGGACAAAATATACAGGTGCACAAGAGCTGGGGTACAGGCCGTAGGTGGTGGAGAGTAAAATAGTTGGTCCTTTGGGTGCCTGATGGTCAGTAGCAAAGTCATAGTTACCGAGGATGGATGACTAATCTCTCTACTTCCACTGCGCGTGCTCTCTCTCCCCTGCAATGATTGGTGAGCACTTCGTGGATGAATGAGCCTGGGGTAAGAATTGCAAAACATATTAACACCTTGGGGAAGTAGCAGCCTCCTTTCCAGATGGAGAAGCCCCAATCCTGGATGGTTCTGTAGAGCGCCTGATGGTCAACTTGCAATACCTCACAGAGCCAGCCCACATCCCACTCAGCTTCCACCAGAAACGTTGTTGGGGAGAGGCAGATATGGCTGGAGCCCTGTCTTCCGGTGCCAGGACGTTACTGGGCTTTGGTATTGACTGAGTGGCTGACAAGTTATCTTCCAACTCCAGTTGGCTGGGCAGGACAAGGGCTAGGAATGACCGTGGTCAGGCCTGCCTGCTCCCAGCCCAGGATGCCCCTGCTATGGACCTTTCATTTCTTTTCATTGGTTTATTTTTCAATGCATCTTTAATTTGTAAAGAAATAAAATAAGATGTAACCAG