Transcript asmbl_13761

Sequence
Transcript Sequence for observation asmbl_13761 of TGE0031983:
CCCCACTCATCCTCTTCCTGCTGTGGTCGCCAGAGCCAGAAGCAGCCTGTCTCCCCGCCCCTGAGCAGGAGCACAAAACCAGAAGTCCCTGCCTTGTACAGGCAGCTCTGAAAGCCTACTGGGAGCATCAAGGCTGCAAACGCTGGATTGAGAAGCCGCAACTGTGACTCTGCATCATGAATACTCTGTCTGAAGGAAATGGCACCTTTGCCATCCATCTTTTGAAGATGCTATGTCAAAGCAACCCTTCCAAAAATGTATGTTATTCTCCTGCGAGCATCTCCTCTGCTCTAGCTATGGTTCTCTTGGGTGCAAAGGGACAGACGGCAGTCCAGATATCTCAGGCACTTGGTTTGAATAAAGAGGAAGGCATCCATCAGGGTTTCCAGTTGCTTCTCAGGAAGCTGAACAAGCCAGACAGAAAGTACTCTCTTAGAGTGGCCAACAGGCTCTTTGCAGACAAAACTTGTGAAGTCCTCCAAACCTTTAAGGAGTCCTCTCTTCACTTCTATGACTCAGAGATGGAGCAGCTCTCCTTTGCTGAAGAAGCAGAGGTGTCCAGGCAACACATAAACACATGGGTCTCCAAACAAACTGAAGGTAAAATTCCAGAGTTGTTGTCAGGTGGCTCCGTCGATTCAGAAACCAGGCTGGTTCTCATCAATGCCTTATATTTTAAAGGAAAGTGGCATCAACCATTTAACAAAGAGTACACAATGGACATGCCCTTTAAAATAAACAAGGATGAGAAAAGGCCAGTGCAGATGATGTGTCGTGAAGACACATATAACCTCGCCTATGTGAAGGAGGTGCAGGCGCAAGTGCTGGTGATGCCATATGAAGGAATGGAGCTGAGCTTGGTGGTTCTGCTCCCAGATGAGGGTGTGGACCTCAGCAAGGTGGAAAACAATCTCACTTTTGAGAAGTTAACAGCCTGGATGGAAGCAGATTTTATGAAGAGCACTGATGTTGAGGTTTTCCTTCCAAAATTTAAACTCCAAGAGGATTATGACATGGAGTCTCTGTTTCAGCGCTTGGGAGTGGTGGATGTCTTCCAAGAGGACAAGGCTGACTTATCAGGAATGTCTCCAGAGAGAAACCTGTGTGTGTCCAAGTTTGTTCACCAGAGTGTAGTGGAGATCAATGAGGAAGGCACAGAGGCTGCAGCAGCCTCTGCCATCATAGAATTTTGCTGTGCCTCTTCTGTCCCAACATTCTGTGCTGACCACCCCTTCCTTTTCTTCATCAGGCACAACAAAGCAAACAGCATCCTGTTCTGTGGCAGGTTCTCATCTCCATAAAGACACATATACTACACAGGGAGAGTTCTCTCTTCAGTATCCCTACCACTCCTACAGCTCTGTCAAGATGGGCAAGTAGGGGGAAGTCATGTTCTAAGATGAAGACACTTTCTTCTTGTCAGCCTGATCTTATAATGCCTGCATTCAACTCTCCCTGTCTTGAATGCATCTATGCCCTTTACCAGGTTATGTCTAATGATGCCAAATACCTTCTGCTATGCTATTGATTGATAGCCTAGCCAGTAATTTATAGCCAGTTAGAACTGACTTGACTGTGCAAGAATGCTATAATGGAGCTAGAGAGAAGGCACAAACACTAGGAAAGGTTGCTGTTTTTGCAGAGGACACAGGGACATTTCCCACCACTCACATGGCTGCTTACAACCTCTGGAAATTCCAGTTTCTGTCCATGACTTGATTCCTTTCTTTGGCTTCTACTGGCTCCAGCATCCTGCACATACATGTATCGTCATTCAGTTACACACAAACAAGTAAAATTTTAAAAATAAATAAAAATTTAAAGAGAGAGTCTAAAATTTTAGTAATGGTTAGATAATAGCTGCTATTGTGCCTTTTTCAGGTTTTAATGTCATTATTCTTGTGTATAAAGTCAATAATTTATAGGAAAACATCAGTGCCATGCTGTGATCTTATCTTCATCCCCTTTCAAACACATTGTTTAACCATCAAGCAGTGACTCTCCATTCTTCCTCCCTTTGGACATATAACCACCAATCTTCTCTCTGTCTCTGTAGCTTTATCTATTTTGGACATTTTATATAGACTGCCTCTTTGCTATCTTGATAATGTCCTTTGATGCATACAGATTGCTTTTTTTCCAGTGATGTTCTCCTTATTTAATACTGTTCTGATCATGAGGTATGCATGCTGCAGCTAAGAATCTCACTACTAAAGTCAAGTATAGAAATAACTGTTCTTATGTTTTCCTCCAAGGCCTTCATGGATTATACCTTATATATCTAGGTCACTGTTCCAGTTTGAATTAAATTCCATATGTGGTGTGGTGTTGGAGCCTGATGTGATTCCTTTATTTGTGAACATCCAGTTGTCGCTGTACTTGTAATTGCTTTGAATCATGAGGTAATGACCAATGAATAGGAAAAATAATGTTACAACTAGTGGGGTAGGATAGAAGTTCCTCAGTACATATATTGAACATTAACACAAGTGTGAAATAAAAATATCAGAAATGAGCAGTAAACAAAGAAGGAGAGATTAAACGTTCTGTAATCAGGGTCCTCAGAAATGACTCAGGGGCTGAAGATGCTTGCTACCCTGCCTGACAACTTGAGTTCTATTTCTGGAACAGACATGGTGGAAGAAGAAAACTGACTCTAGCAAGTTGTCCTCTGACCTCACCATGAGCATGATGCACAAATAAATATCCCTGTTAATCAGATATAATTATGCAGTAAGTTAATAATCAGAAAAAATACACATATAAAAACCAATTCCTTATCAACAAGTTAATCTTGCTAGGAAGAGCCAGGAAAAAGAGTAATAGGGGACCATGTGATCCTAAAAGGGATAAAGCTAAGCCAGGATATACTCTTATACATCAACATGTGTCCTGGTTTCCAGAAGGTTCAATTTGAGGACATATCCCAATGATGTCATTACTGAAGTCCACAAAAAGACAGTGACTATGATCTCTGTAGCCATATTTATAGCAGCAAATAATGGATCCAGGTGTCAATCTCATACAGTAAACAAAGAAGTCATGTTGTACACTTAATACTGAATGGAAGTTAGAAAGTTGTACCAGATAGTTTTTATATTAATGTGATACAAGGTAGAGTCACTGGAGAGGAAAGAGCCTCAATTAAGAAATGTCTCCATATGCTCTGGAGCATTAATGTGAGAAGGCTAGGCCCATTGTATGTGAGACAATCCCTATGCAGGTGGTCCTCTGATTATAAGGAAGCAGGCTGAACAAACCAGGAGGAGCAAGCCAGTAAGCAGCATTCCTCTGTGGCCTCTGCATCAGCTCCTGCCT