Transcript asmbl_69500

Sequence
Transcript Sequence for observation asmbl_69500 of TGE0007389:
CCCGACTGGAGTTGCTCTCGTAACGGACGAGCGTCTGTGGAGAAGCGGCTTTCTCTCTTATTGTCTCGTGGGCCCCGCTGGTTTAGTTGCTTGCAGGGTTCTCGAGCCCTTTCACGACCGTCACCATGGAGGTGTCACCACTGCAGCCTGTAAATGAAAATATGCAAATCAACAAAACAAAGAAAAATGAAGATGCTAAGAAAAGACTGTCTATTGAAAGAATCTATCAAAAGAAAACACAGTTGGAACACATTTTGCTCCGTCCAGACACTTACATTGGCTCTGTGGAATTAGTGACCCAGCAAATGTGGGTTTACGATGAAGATATTGGCATTAACTATAGGGAAGTCACTTTCGTTCCTGGTTTATACAAAATCTTTGATGAGATTCTAGTCAATGCTGCAGACAACAAACAAAGAGACCCAAAAATGTCTTGTATTAGAGTCACAATTGACCCGGAAAACAATTTAATTAGTATATGGAATAATGGAAAAGGTATTCCTGTTGTTGAACACAAAGTTGAGAAGATGTATGTCCCAGCTCTCATCTTTGGACAGCTCCTAACTTCTAGTAACTATGATGATGATGAAAAGAAAGTAACAGGTGGTCGAAATGGCTATGGAGCCAAATTGTGTAACATATTTAGTACCAAATTTACTGTGGAAACAGCCAGTAGAGAATACAAGAAAATGTTCAAACAGACGTGGATGGATAACATGGGGAGAGCTGGTGAGATGGAACTCAAGCCCTTTAATGGAGAAGATTATACATGTATTACCTTCCAGCCTGATTTGTCTAAGTTTAAAATGCAGAGCCTTGACAAAGATATTGTTGCACTGATGGTTAGAAGAGCATATGATATTGCTGGATCCACTAAAGATGTCAAAGTCTTTCTCAATGGAAATAAGTTGCCAGTGAAAGGATTCCGTAGCTATGTGGATATGTATTTGAAGGATAAAGTAGATGAAACTGGCAATCCATTGAAAATCATCCACGAACAAGTAAACCACAGGTGGGAAGTGTGTTTAACAATGAGTGAAAAAGGCTTTCAGCAAATTAGCTTTGTCAACAGCATTGCTACTTCCAAGGGTGGCAGACATGTTGATTATGTAGCTGATCAGATTGTGACTAAACTTGTTGATGTTGTGAAGAAGAAGAACAAGGGCGGTGTTGCAGTAAAAGCACATCAGGTGAAAAATCACATGTGGATTTTTGTGAATGCCTTAATTGAAAACCCAACCTTTGACTCTCAGACAAAAGAAAACATGACTTTACAAGTCAAGAACTTTGGATCAACATGCCAACTAAGTGAAAAATTCATCAAAGCTGCAATTGGCTGTGGTATTGTAGAAAGCATACTAAACTGGGTGAAGTTTAAGGCTCAAATCCAGTTAAACAAGAAGTGTTCCGCTGTGAAACATAACAGAATCAAGGGTATTCCCAAACTTGATGATGCCAATGATGCAGGGGGCCGAAACTCCACTGAGTGTACACTTATCCTGACCGAGGGAGACTCAGCTAAAACTTTGGCTGTTTCAGGCCTTGGTGTGGTTGGGAGAGATAGATATGGGGTTTTCCCTCTTAGAGGAAAAATACTCAATGTTCGAGAAGCTTCTCATAAACAGATAATGGAAAATGCCGAAATTAACAATATCATCAAGATTGTGGGTCTTCAATACAAGAAAAACTATGAAGATGAAGATTCATTGAAGACTCTTCGTTATGGGAAGATAATGATTATGACAGATCAGGACCAAGACGGTTCCCATATCAAAGGCTTGCTGATTAATTTTATCCATCACAACTGGCCCTCTCTTCTGCGACATCGTTTTCTGGAGGAATTTATCACTCCCATTGTAAAGGTGTCTAAAAACAAGCAAGAAATGGCATTCTATAGTCTGCCTGAATTTGAAGAATGGAAGAGTTCTACACCAAATCATAAAAAATGGAAAGTCAAGTATTACAAAGGTTTGGGCACCAGCACATCAAAAGAAGCTAAAGAATACTTTGCAGATATGAAAAGACATCGTATCCAGTTCAAATATTCTGGTCCTGAAGATGATGCTGCAATCAGCCTGGCCTTTAGCAAAAAACAGATAGATGATCGAAAGGAATGGTTAACTCATTTCATGGAGGATAGAAGACAACGAAAGTTACTTGGCCTTCCTGAGGATTACTTGTATGGGCAAACAACCACATATCTGACCTACAATGACTTCATAAACAAGGAACTAATCCTGTTCTCAAATTCTGATAACGAGAGATCTATCCCGTCTATGGTGGATGGTTTGAAACCAGGTCAGAGAAAGGTTTTGTTTACGTGTTTCAAACGGAATGACAAGCGAGAGGTGAAGGTAGCCCAGTTAGCTGGGTCAGTGGCTGAGATGTCCTCTTATCATCATGGTGAGATGTCACTAATGATGACCATTATCAATTTGGCTCAGAATTTTGTGGGTAGCAATAATCTGAACCTCTTGCAGCCCATTGGTCAGTTTGGTACCAGGCTGCATGGTGGCAAGGATTCTGCTAGTCCTCGATACATCTTCACAATGCTCAGCCCTTTGGCTCGGTTGTTATTTCCACCACAAGATGATCACACATTAAAGTTCTTATATGATGACAACCAGCGTGTGGAGCCTGAGTGGTACATTCCTATTATACCCATGGTGCTGATAAATGGTGCTGAAGGAATTGGTACTGGGTGGTCCTGCAAAATTCCCAACTTTGATATTCGTGAAGTCGTGAATAATATCAGGCTTTTGATGGATGGAGAAGAACCTTTGCCAATGCTTCCCAGTTACAAGAACTTCAAGGGTACTATTGAAGAGCTGGCTCCAAATCAGTATGTGATTAGTGGTGAAGTGGCTATTCTTAATTCCACAACCATTGAAATCTCAGAGCTTCCCATCAGAACATGGACCCAGACATATAAAGAACAGGTTCTGGAACCAATGTTGAACGGCACAGAGAAGACACCTCCTCTTATAACAGATTATAGGGAATACCATACAGATACCACTGTGAAGTTTGTTGTGAAAATGACTGAAGAAAAACTGGCAGAGGCCGAGAGAGTGGGACTACACAAAGTCTTCAAACTCCAAACTAGTCTCACATGCAACTCTATGGTGCTTTTTGACCACGTAGGCTGTTTAAAGAAATATGACACAGCGTTGGATATTCTAAGAGACTTCTTTGAACTCAGGCTTAAATATTATGGATTAAGAAAAGAATGGCTTCTAGGAATGCTTGGCGCTGAATCTGCTAAACTGAACAATCAGGCTCGCTTCATCTTAGAGAAAATAGATGGCAAAATAATCATTGAAAATAAGCCTAAGAAAGAATTGATTAAAGTTTTGATTCAGAGAGGATATGATTCGGATCCTGTGAAAGCTTGGAAAGAAGCCCAGCAAAAGGTTCCAGATGAAGAAGAAAACGAAGAGAGCGATAATGAAAAGGAAACTGAAAAGAGTGACTCTGTAACTGGACCAACCTTCAACTACCTTCTTGATATGCCTCTTTGGTATCTTACCAAGGAAAAGAAAGATGAACTATGCAAATTAAGAAAGGAAAAAGAACAAGAGCTAGAAACATTAAAGAAAAAGAGTCCATCAGATTTGTGGAAAGAAGACTTGGCTGCTTTTATTGAAGAGCTGGAGACTGTTGAAGCCAAGGAAAAACAAGATGAACAAGTAGGACTTCCTGGGAAAGGGGGGAAAGGAAAAGGGAAAAAAACACAAATGGCTGAAGTTTTGCCTTCACCAAGTGGAAAAAGAGTCATTCCCCGAGTTACCATAGAGATGAAAGCAGAGGCAGAAAAGAAAATTAAAAGGAAAATTAAGAATGAAAATTCTGAAGGAACTCCTCAAGAGAATGGTATGGAACCCGAAAGCCTAAAACAAAGATTAGAGAAGAAACTGAAAAAAGAACCAGGTACCAAGACGAAGAAACAAACTACATTGCCATTTAAACCAGTCAAAAAAGGAAAGAAGAGAAACCCCTGGTCTGATTCAGAATCAGATGCGAGCAGTAACGAAAGTGATTTTGATGTCCCTCCACGAGAAATAGAGCCACGGAGAGCAGCAACAAAAACCAAATTCACAGTGGATTTAGATTCAGATGAAGATTTCTCAGATTTTGATCAAGAAACTCAAGATGAAGATTTTGTGCCATCTGATGCTAGTCCAGTTAAGACCAGAACTTCCCCGAAACGTGCTAACAAAGAACTGAAGCCACAGAAGAGCACCACGTCAGTAACGGACTTTGATGCTGATGATGCCAAGGACGATGTTCCACTTTCTCCAAGTTCTCCTGCTGCTGATTTCCCAGCCGAAACAGAAATTGTAAACCCTGTTTCTAAAAAGAACGTGACAGTGAAGAAGACGGCAGCAAAAAGTCAGTCTTCCACCTCGACTACAGGTGCCAAAAAAAGGGCTGCACCAAAAAGAACCAAAAAGGATCCAGGCGTGAATTCTGATGCCCCTCAAAAGCCTGATCCCCCCAAAACCAAGACTCGCCGCAAAAGAAAGCCATCCACTTCTGATGATTCCGACTCTAACTTTGAGAAAATGATTTCTAAAGCAGTCACAAGCAAGAAATCCAAGGGGGAGAGTGATGACTTCCACCTGGACTTAGACTCAGCTGTGGCTCCTCGTGTAAAATCTGGGCGGGCAAAGAAGCCGATAAAGTACCTTGAAGAATCAGATGAAGATGATCTGTTTTAAAATGTGAGGTGACTATTTTTAGTGGTCTTATTGAGCCCAAGACTGGTTTGAATCTCTTAATTTCCTCCCCTTTAAATTTAGTTTGGGGAAAGTAGTTTTGATCTAAAATCACCAAAGTGAAGTATGTAGAGCCCAGCGTCCCTTATCTTTTTATGATACAGTCTAAATGGTGATACATCTCATGGGCATTGTTTTTTTCTCTGCTTTGTCTGTATTTTCATTCTGTTTCCTTTTGTCTTTAAAATCTGATTTTAACTTCTGGACTCCAGAGATAGTTATGTGGTCATTCCAGCATAATGTAGTTTGTTTATTGACCATACATTAAGCTAAAATTGGAGCACTTTGATATAAAAGTGTCTACTGTGCCTCCTTTCTTACCTTCATAAATATGAGATAGAGCATGATTAATTCTGTTTTATCTTAGTTATATAGGTAATTTTCCATCAGATAGAATTTTATAGTTCTAGTACAAATACTCCCCACTCAGCCTTTTATGTGCTGAATTTTTGTTCAAACAATGAGATATTGCTCATATTCTTCATACTCTTTTAGAATGTCAGCAGAGGCTAAAGAAAAACACCTTGGCTGTGTCTGTAGAACCTCAACACAGTCAAGAGGATGAAGAAAATTAGACCATAAGTTATATAAACCAGTGCTGTCTCAACTCTTGACTGTCCCCTCTGGCTGCCTCTGAGTCTGAATTTCCCAAAGAACAAATTTCTGGGGAGCACTAGATTGCAGAAGAGTGGGGACAGCATTCATTCAGAGACCTTAAATATTTTATTGATACCATATTCAGCAATGAGCTTTTATATCCATTTTGAGAAATCTCCATAATTTTCAACTTGTAAACTTTTTAAAGACCTTTCTGCATTTTACACATCTGTGATTTGAAT