Transcript asmbl_69483

Sequence
Transcript Sequence for observation asmbl_69483 of TGE0007379:
GAGTGGCGGGCGGCTGCTTTCACGGGAGGGCCCCGACCTGGCCCAGGAGCTTCCTGCTTCCCTCCCTCAACCCGGAACCTCCTCTCCGGATGCCGGCTTGCTGTTCACGTGCCCTCCTTGCACCTGTTTGGAAGTTTTGGTTGTCGTAGCTTTCGGTAGAGCAGGTCCCTCTGCAGCCATGTCGGCCAAGGCGATTTCAGAGCAGACTGGCAAAGAACTTCTTTACAAGTACATCTGCACCAGCTCGGCCATCCAGAACCGGTTCAAGTATGCCAGGGTCACCCCTGACACAGACTGGGCCCATCTGCTGCAGGACCACCCCTGGTTGCTCAGCCAAAGATTGGTGGTCAAGCCAGACCAACTGATCAAACGACGTGGAAAGCTGGGCCTAGTTGGGGTCAACCTCACTCTGGATGGTGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCTCTGGTAGGCAAGGCCAGAGGCTTACTCAAGAACTTTCTGATCGAACCCTTCGTCCCACACAGTCAGGCAGAAGAGTTCTACGTCTGCATCTATGCTACCCGAGAAGGTGACTACGTCCTGTTCCACCACGAGGGAGGGGTGGACGTAGGCGACGTGGATGCCAAAGCCCAGAAACTGCTCGTTGGTGTGGATGAGAAGCTGAATCCTGAGGACATCAAGAAACACCTATTGGTCCATGCCCCTAAAGACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGGCCTCTTCAATTTATATGAAGATCTGTACTTCACCTACCTCGAGATCAACCCCCTTGTTGTGACCAAAGATGGCGTCTACATTCTTGACTTGGCGGCTAAGGTAGATGCCACTGCCGATTACATCTGCAAAGTGAAGTGGGGCGATATAGAGTTCCCTCCCCCCTTTGGGCGTGAGGCTTATCCAGAGGAAGCCTACATTGCAGACCTGGATGCCAAAAGTGGAGCAAGCCTGAAGCTGACCTTGCTGAACCCCAAGGGGAGGATCTGGACCATGGTGGCTGGGGGTGGTGCCTCAGTCGTGTACAGTGATACCATCTGTGACCTAGGGGGTGTCAATGAGCTGGCGAACTATGGGGAGTACTCGGGTGCCCCCAGCGAGCAGCAGACCTATGACTATGCCAAGACGATCCTCTCCCTCATGACCCGCGAGAAGCACCCAGATGGCAAGATCCTCATCATTGGAGGCAGCATTGCGAACTTTACCAACGTGGCTGCCACGTTCAAGGGTATTGTGAGAGCGATTCGAGATTTCCAGGGCCCCCTAAAGGAGCACGAGGTCACTATCTTTGTCCGAAGAGGTGGTCCCAACTATCAAGAGGGCTTACGGGTGATGGGAGAAGTTGGGAAGACCACTGGAATCCCCATCCATGTGTTTGGCACAGAGACTCATATGACGGCCATTGTGGGCATGGCCCTGGGCCACCGGCCCATCCCCAATCAGCCACCTACAGCCGCCCATACTGCAAACTTCCTCCTCAACGCCAGTGGGAGCACATCGACTCCAGCCCCCAGCAGGACTGCGTCTTTTTCTGAGTCCAAGGCTGATGAAGTGGCACCTGCAAAGAAGGCCAAGCCTGCTATACCACAGGGGAGGAGTGCCACCCTCTTCAGCCACCACACCAAGGCCATCGTGTGGGGCATGCAGACGCGGGCCGTGCAAGGCATGCTGGACTTTGACTACGTCTGCTCCAGAGACGAGCCCTCAGTGGCTGCCATGGTCTACCCTTTCACTGGGGACCACAAGCAGAAGTTTTATTGGGGTCACAAAGAGATCCTGATCCCTGTCTTCAAGAACATGGCTGATGCCATGAAGAAACACCCTGAGGTAGATGTGCTGATCAACTTCGCCTCTCTCCGCTCCGCCTATGACAGTACCGTTGAGACCATGAGTTATGCACAGATCCGGACCATTGCCATCATAGCTGAAGGTATCCCTGAGGCCCTCACGAGGAAGCTGATCAAGAAGGCAGAGCAGAAGGGTGTGACCATCATTGGACCTGCCACTGTTGGAGGCATCAAGCCTGGGTGCTTTAAAATCGGGAATACAGGTGGGATGCTGGACAACATCCTGGCTTCCAAACTGTACCGCCCTGGCAGCGTGGCCTACATCTCGCGTTCTGGGGGCATGTCCAACGAGCTCAACAATATCATCTCTCGAACCACGGATGGTGTCTATGAGGGCGTGGCCATTGGTGGGGACAGGTACCCTGGTTCAACATTTATGGATCACGTGTTACGTTACCAGGACACTCCAGGAGTCAAAATGATTGTGGTTCTTGGAGAGATAGGGGGCACTGAGGAGTATAAGATCTGCCGGGGCATCAAGGAGGGCCGCCTCACCAAGCCTGTGGTCTGCTGGTGCATCGGGACCTGTGCTACCATGTTCTCTTCTGAGGTACAATTTGGCCATGCCGGAGCTTGTGCCAACCAGGCTTCTGAAACTGCAGTAGCCAAGAACCAGGCTTTGAAAGAGGCAGGAGTCTTTGTGCCCCGGAGCTTCGATGAACTTGGAGAAATCATCCAGTCTGTGTACGAGGATCTTGTGGCCAAAGGGGCCATTGTACCTGCTCAGGAGGTACCGCCCCCGACGGTGCCGATGGACTACTCCTGGGCCAGGGAGCTGGGCTTGATCCGCAAACCTGCCTCATTCATGACCAGCATCTGCGACGAGCGAGGACAGGAGCTCATCTACGCGGGTATGCCCATCACTGAGGTCTTCAAGGAAGAGATGGGCATTGGCGGGGTCCTCGGTCTCCTCTGGTTCCAGAGAAGGTTGCCCAAGTACTCCTGCCAGTTCCTTGAGATGTGCCTGATGGTGACAGCCGATCATGGGCCAGCCGTGTCTGGCGCTCACAATACCATCATCTGTGCTCGGGCTGGGAAGGACCTGGTTTCCAGCCTCACCTCGGGGCTGCTCACTATTGGGGACCGGTTTGGGGGCGCCCTGGATGCAGCAGCCAAGATGTTCAGCAAAGCCTTCGACAGTGGCATTATTCCCATGGAGTTTGTAAACAAGATGAAGAAGGAAGGAAAACTGATCATGGGCATCGGTCACCGAGTGAAGTCGATAAATAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAAACAGCACTTCCCTGCCACCCCCCTGCTCGACTATGCGCTGGAAGTGGAGAAGATTACCACCTCAAAGAAACCGAATCTTATCCTGAATGTAGATGGCTTCATCGGAGCTGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAAGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGCTTCATTGGACACTATCTTGATCAGAAGAGACTGAAGCAGGGGCTGTATCGTCACCCATGGGATGATATTTCATATGTTCTTCCGGAACACATGAGCATGTAACTGAGCCAGGAACTGTGTTGCAGTAAAGTGAAGACAAGATCTCCTCCCCCCAGAAATAGTGTGCAGACAGCTGGCACTGGAGCTTGCTATAGGATGGGCCTGGAATATAAACAGCCGTTGGTATACAGGCACCGAAGACCAATACTCACAGGCTAACACTGTTTAGTCCACACAATGAAGCTTAATATTTTTTTTATAAGCATAGAAATAAAAACCAAGCCAATATTTGTGACATCTGCTCTGCCACCTGCTGTGTTTATTATATAAAAGCATCTAAGCACTGTCAGGATGGCATTTTTCCTTATTATAGGGCGTTATAATGTTGCTTTCTTTTTTCCGTTAGTTAAAAATTTTCCCTTGGAGGAAGGGAATGAAACTTTTAAGACTTCAAGATATTATACATTTAAAGCATCCCTAATGTCTTGTTTTCCTGCTTATATAACCTGAAGAGCATTGTATTAATCTGATTTTTTTTTATGATCTTTTTGTATGTTATGCGTGAAGGATTTGTTCGGTATCTCACTGAAACATTTCATGTTGTAGACTAAAGTCTGCTTCTGTCAGGGGGATTGGACCATTGCATCCTTAGCCACTATCACAAAATATGTGGAATAGTGATTTAAAATGTAAAGTTGCAACATACATGTTTAAAATGGAAACACAAAGAAAAAGCTGTGAAATGTCTTGTGTCTTATGTTCTCTGTATTTATGCAACTGATCTGTCTTACTGAAGTCTGGGTCCAAGGACTCATCTCCAACCAGTTTGCATCTGTAATCCACAAAGATTCTGGGCAGCTCCCACCTCAGTCTCTTCTCTGTATTATCATAATTTGGTTTAAATAAACTATATAGTAACAATGAATACATACTGCTCTCTTTCATCTGCATTCCTTTGAACTGTACTTCCTAATAATTT