Transcript asmbl_11109

Sequence
Transcript Sequence for observation asmbl_11109 of TGE0031747:
CGGCGCGCGCCTTACATCCGGTTCCCGCCGCGGCTTGCAGTTGTCTTTCTGCGGAATCCGGATCATGGCGGCTAACGCCACGATGGCGACGTCTGGCTCGGCGCGGAAGCGGCTGCTCAAAGAGGAGGACATGACCAAAGTGGAGTTCGAGACGAGCGAGGAGGTGGACGTGACCCCCACGTTCGACACCATGGGCCTGCGAGAGGACCTGCTGCGCGGCATCTACGCCTACGGTTTTGAAAAACCTTCAGCGATTCAGCAGCGTGCTATCAAGCAGATAATTAAAGGGAGAGATGTCATTGCACAGTCTCAGTCTGGCACAGGCAAGACGGCCACCTTCAGTGTCTCAGTGCTGCAGTGCTTGGATATCCAGGTTCGAGAAACCCAAGCTTTGATCCTGGCTCCAACCAGGGAGTTAGCGGTGCAGATTCAGAAGGGTCTGCTCGCGCTGGGGGATTACATGAACGTGCAGTGCCATGCCTGCATTGGGGGCACCAACGTCGGCGAGGACATCCGGAAGCTGGACTACGGACAGCACGTGGTGGCAGGCACGCCGGGACGCGTCTTTGATATGATCCGCCGGAGAAGTTTACGGACACGGGCTATCAAGATGCTGGTTTTGGATGAGGCTGATGAAATGTTGAACAAAGGTTTCAAGGAGCAGATCTATGATGTGTACAGGTACTTGCCACCAGCCACACAGGTCGTCCTCATCAGCGCCACACTGCCTCATGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCTTGGTGAAGCGTGATGAGTTGACTCTGGAAGGCATCAAACAGTTCTTTGTGGCTGTGGAAAGAGAGGAATGGAAATTTGATACTCTATGTGATCTCTATGACACGCTGACCATCACCCAGGCCGTCATCTTCTGCAACACCAAGCGGAAGGTTGACTGGCTGACAGAGAAAATGAGAGAAGCCAATTTCACTGTGTCGTCCATGCATGGAGACATGCCCCAGAAAGAACGAGAGTCTATCATGAAGGAGTTCCGGTCAGGTGCCAGCCGGGTGCTCATCTCCACAGACGTCTGGGCCCGGGGCCTGGATGTCCCTCAGGTGTCCCTCATCATTAACTACGACCTGCCCAACAACAGAGAACTGTACATTCACAGAATTGGGAGATCGGGTCGGTATGGACGAAAAGGTGTGGCCATCAATTTTGTGAAGAATGATGACATCCGGATTCTCAGGGACATTGAGCAGTACTACTCCACCCAGATAGACGAGATGCCCATGAATGTGGCTGACCTCATCTGAAGCTGGTGCTGGTGCACCGAGGCCCTGTTTGGAAACGGAAGCTTCTATTTAATGGGGTTGATATGGACTGTCTTCTCGGAGCCCCTCGGGAAGACCCTCAGCCTCCGCCATCTTTTCTAATGCACATGTACATAATCCGATGCTTAACCTTTTACATTAAACGTGGACATTTTCCTGTG