Transcript asmbl_69377

Sequence
Transcript Sequence for observation asmbl_69377 of TGE0007360:
AGCAGCAGCAGCAGCAGCCGCCGCACCACCACCACCATTATTATTACTACAACCACAGCCACAACCACCATCACCACCACCATCACCAGCAGCCTCACCAATACCTGCAGCATGGAGCCGAGGGCAGCCCCAAGGCCCAGCCAAAGCCGCTGAAACATGAGCAGAAACACGCCCTCCAGCAGCACCAGGAAACGCCGAAGAAGAAAACAGGCTATGGTGAACTAAATGGTAATGCTGGAGAAAGAGAAGTATCTTTAAAGAACCTGGGTTCTGATGAAGCTACCAGCCCAATTTCCAGGGTCCTCAATGGCAACCAACAAGTTGTAGACACTAATCCGAAGCAGACTGTAAAGACCAGCACCTTTGGGAAAGCAGGAATTAAAACCAGGAATTTCATTCAGAAGAACAGTATGGACAAAAAGAATGGAAAGTCTTATGAAAATAAATCTGGAGAGAACCAGTCTGTAGATAAGAGTGATGCTGTAGCAATTCCAAATGGTGTTGTAACAAATAATTCTGGCTATATTACTAATGGTTATATGGGCAAAGGAGCAGATAATGATGGTAGTGGATCTGAGAGCGGATATACCACTCCTAAAAAAAGGAAAGCTAGGCGCAATAGTGCCAAGGGTTGTGAAAACCTTAATTTAGTGCAGGACAAAATAATGCAACAAGAGACCAGTGTCCCAACCTTAAAACAGGGACTTGAAACTTTCAAGCCTGACTATAGTGAACAAAAGGGAAATCGAGTAGATGGTTCAAAGCCCATTTGGAAGTATGAAACTGGGCCTGGAGGAACAAGTCGAGGAAAACCTTCTGTGGGTGATATGCTGCGGAAAAGTTCTGATATTAAACCTGGCGTGAGCAGCAAAAAATTTGATGACCGGCCCAAAGGAAAGCATGCTTCTGCTGTTGCCTCCAAAGAGGACTCATGGACCCTATTTAAACCACCTCCAGTTTTTCCAGTAGACAATAGCAGTGCTAAAATAGTTCCTAAAATAAGTTATGCAAGCAAAGTTAAGGAAAACCTCAACAAAACTGTACAGAACTCTTCTGTGTCACCATCTTCATCTTCATCCTCTTCATCATCTGTTGGGGAAACTCAGACCCAATCTTCAAGTCGGTTATCCCAGGTCCCTATGTCAGCGCTGAAATCTGTTACTTCAGCCAGCTTTTCTAATGGACCTGTTTTAGCAGGGACTGATGCAAGTGTGTATTCTCCAGGGGGTCAGCCACTGCTAACTACTGCTGCTAATACGCTAACACCCACCTCTTCTGGGACTGATTCAGTTCTCCAGGACATGAGTCTGACTTCAGCAGCTGTTGAACAAATTAAGTCTAGCCTTTTTATCTACCCTTCAAATATGCAAGCTGTGCTGTTGAGCACAGCACAAGTGGATCTACCCTCTCAGACAGATCAGCAAAACCTGGGGGATATCTTCCAGAATCAGTGGGGTTTATCATTTATAAATGAACCCAGTGCTGGCCCTGAGACTGTTACTGGGAAGTCATCAGATAAAGTGATGGAGGTGACATTTCAAGGGGAATATCCTGCCACTTTGGTTTCACAGGGTGCTGAAATAATCCCCTCAGGAACTGAGCATCCTGTGTTTCCCAAGGCATATGAGCTGGAAAAACGGACTAGTCCTCAAGTTCTGGGTAGCATTCTAAAATCTGGGACTACTAGTGAGAGTGGAGCCTTATCCTTGGAACCCAGTCATATAGGTGACCTGCAAAAAGCAGACACCAGTAGTCAAGGTGCTTTAGTGTTTCTCTCAAAGGACTACGAGATAGAAAATCAAAATCCTCTGGCATCTCCTACGAACACTTTGTTAGGCTCCGCCAAAGAACAGAGATACCAGAGAGGCCTAGAAAGGGATGATAGCTGGGGTTCTTTTGACCTGAGGGCTGCTATTGTATATCACACTAAAGAAATGGAATCTGTTTGGAATTTGCAGAAGCAAGATCCCAAAAGGATAATCACTTACAATGAAGCCATGGATAGTCCAGATCAATGAAGGACCAGACTGCCTATTTGTAACCTTCCTGCAGCATTAGAGCCACCGTTCATGGGGGACACAAGGCTTTTATGCTCCTAGATCTTCAACGCAGCAGAGGAACCATAAGTAGAATCACAGGATAATATATACATATATATATATACAT