Transcript asmbl_11001

Sequence
Transcript Sequence for observation asmbl_11001 of TGE0050441:
CACAGCCGGAGCCCGCGGCAGAGTCGGAATCCGGGGTCGGGCTGGAGCGGGGTCCATCGACATGGGATCCGCAGACTCCAAGCTGAACTTCCGGAAGGCGGTGATCCAGCTGACCACCAAGACGCAGCCCGTGGAAGCCACCGACAATGCTTTCTGGGACCAGTTCTGGGCAGACACCGCTACCTCGGTGCAGGATGTCTTTGCGTTGGTGCCGGCAGCAGAGATCCGGGCTGTGCGAGAGGAGTCACCCTCTAACCTGGCCACGCTGTGCTACAAGGCTGTGGAGAAGCTGGTGCAAGGAGCAGAGGGTGGCTGCCACTCTGAGAAGGAGAAACAGGTCGTCCTGAACTGCAGCCGGCTACTCACCCGAGTGCTGCCTTACATCTTCGAGGACCCCGACTGGAGGGGCTTCTTCTGGTCCACAGTGCCCGGGGCAGGGCGTGGAGGGGGTGAGGAAGAGGATGAGAACGCTCGTCCCTTGGCTGAGTCCTTGCTCCTGGCCATTGCCGATTTGCTCTTCTGCCCAGACTTCACTGTGCAGAACCACCGGAGGAACGACGTGGACTCAGCAGAAGATGTCCATTCCCTGGACAGCTGTGAATATATCTGGGAGGCTGGTGTGGGCTTTGCTCATTCCCCACAGCCCAACTACATCCATGACATGAACCGGATGGAGCTGCTGAAGTTACTGCTCACGTGCTTCTCAGAGGCCATGTACCTGCCCCCATCTCCAGAGAGTGGCAGCACCAACCCCTGGGTTCAGTTCTTTTGTTCCACGGAGAACAGACACGCGCTGCCCCTCTTCACTTCACTCCTCAACACCGTGTGTGCCTATGACCCTGTGGGCTACGGGATCCCCTACAACCACCTGCTCTTCTCGGACTACCGGGAGCCCCTGGTGGAGGAGGCTGCTCAGGTGCTTATTGTCACCTTGGACCATGACAGTGCTACCAGCACCAGCCCCACCGTGGACGGCACCACCACGGGCACAGCTATGGATGATGCTGATCCTCCAGGGCCCGAGAACCTGTTTGTGAACTACCTGTCCCGAATTCATCGTGAGGAGGACTTCCAGTTCATCCTCAAGGGGATCGCTCGGCTGCTGTCCAATCCCCTGCTCCAGACCTACCTTCCCAACTCCACCAAGAAGATCCAGTTTCACCAGGAGTTGCTTGTTCTCTTCTGGAAACTCTGTGACTTCAACAAGAAATTCCTCTTCTTTGTACTGAAGAGCAGTGACGTGCTGGATATCCTGGTTCCTATCCTCTATTTTCTCAACGACGCCCGGGCAGATCAATCTCGGGTGGGCTTGATGCACATCGGGGTCTTCATCCTGCTGCTCCTGAGTGGGGAGAGGAACTTTGGGGTACGGCTGAACAAGCCCTACTCAGTGCGCGTGCCCATGGACATCCCGGTCTTCACAGGCACACATGCAGATTTGCTCATTGTGGTATTCCACAAAATCATCACCAGCGGTCATCAGCGGTTGCAACCCCTCTTCGACTGCCTGCTCACCATTGTGGTCAACGTGTCTCCCTACCTCAAGAGCCTGTCCATGGTGACTGCCAACAAGCTCCTGCATCTGCTCGAGGCCTTCTCGACCACCTGGTTCCTCTTCTCGGCATCTCAGAACCACCATCTGGTCTTCTTCCTTCTGGAGGTCTTCAACAACATTATCCAGTACCAGTTTGATGGCAATTCCAACCTGGTCTATGCCATCATCCGTAAACGTGCGGTCTTCCACCAGCTGGCCAACCTGCCCACTGACCCACCCTCCATCCACAAGGCACTTCAGCGGCGGCGGAGGACACCAGAGCCCCTGTCCCGTACTGGTTCCCAGGAGGGAACGTCCATGGAGGGATCCCGCCCTGCTGCCCCTGCAGAACCAGGCACCCTTAAGACTAGCCTGGTGGCCACTCCAGGCATCGACAAGCTGACAGAGAAATCCCAGGTATCAGAGGACGGCACCTTGAGGTCTCTAGAGCCCGAATCCCAGCAAAGCTCAGCAGAAAACAGCCCATCTGATGGGGAGTCCAGCCAAACATGGAGAGAGCAACGGAGATTGTCCAATGCATCAGCCAGTGGCCAGTGGAGCCCAACATCAGATTGGATCTTGTCCTGGAAGTCAAAGCTGCCGCTGCAGACCATCATGCGCCTGCTGCAGGTCCTGGTTCCCCAGGTGGAGAAGATCTGCATTGACAAGTGAGTCCAGAAGCTGTCCATGGAGGGGGCGAGCACGTGACCGTGGGGAGG