Transcript asmbl_10961

Sequence
Transcript Sequence for observation asmbl_10961 of TGE0039066:
TTTCCATCGGTCCTTGCCCTCGCAGCTCCGGCCCTCGACACCACCGGCCCCTCCGCTGGTGACGCCCCCGCAGAGGCTTCGCCGTCGCCGAGGCCTTCTCTCCGCGACTCGTCGCCGCAGGATTCTACTTTCACTGGGTTCCGCCCGCACACCGCCACCATTGACGCCATGTCGAGTTATTCTAGTGACCGAGACCGCGGCCGGGATCGAGGGTTTGGTGCACCTCGATTTGGAGGGAGTAGAACAGGACCCCTCTCTGGAAAGAAGTTTGGAAATCCTGGGGAGAAACTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCCAAATTTGAGAAGAATTTTTATCAAGAACACCCTGATTTGGCAAGGCGCACCGCACAAGAGGTAGATACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGTCCAAAACCTGTTCTGAATTTTTATGAAGCAAACTTTCCTGCGAATGTCATGGATGTGATTGCAAGGCAGAACTTTACTGAACCCACTGCTATTCAAGCTCAGGGCTGGCCAGTTGCTCTCAGTGGATTGGATATGGTTGGAGTAGCTCAGACTGGATCTGGGAAAACATTATCTTATTTGCTGCCTGCCATTGTACACATAAACCACCAGCCATTCCTAGAGAGAGGTGATGGGCCTATTTGCTTGGTGCTGGCACCAACTCGAGAACTGGCACAGCAGGTGCAGCAAGTGGCTGCTGAATATTGTCGAGCTTGTCGCTTGAAGTCTACTTGCATCTATGGTGGTGCTCCCAAAGGACCACAGATTCGTGATTTGGAAAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGGAAAACCAATCTGAGAAGAACAACTTACCTTGTCCTTGATGAAGCTGATAGGATGCTTGATATGGGATTTGAACCCCAGATAAGGAAAATTGTGGATCAAATAAGACCTGATAGGCAAACACTAATGTGGAGTGCAACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATCAATATTGGTGCACTGGAACTGAGTGCAAACCATAACATTCTTCAGATTGTGGATGTATGTCATGATGTCGAAAAGGATGAAAAGCTTATTCGTCTGATGGAAGAAATCATGAGTGAGAAGGAGAATAAAACTATTGTTTTTGTTGAAACCAAAAGAAGATGTGATGAACTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGCATCCATGGTGACAAGAGTCAGCAGGAACGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACCGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGGGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGACGATCGTCGTGACAGATACTCTGCAGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAACTATGACAGAGGCTACTCTAATCTGCTTAAGAGAGATTTTGGGGCTAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTATCTGCTGGCATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAACGGTTATGATAGCACTCAGCAATATGGAAGTAATGTTGCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACCGCAGCTGCTGCGCCTATGATTGGCTATCCCATGCCAACAGGGTATTCTCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCAGACAAGATAGTTATTTAAGAAACATGGGAAATGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAACTGTACAGTGATTTCAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAGATATTTGAAGACTGAATTAAGTGAAATTGTACTTTATTTTACATATATAATGTCATGTACAACTTGGCTTAGATAGTGTTTTTGGGGGGGATTTTTGTTTTGGTGTTTATTTTTACACAAGGAAAGTTGACTACTTCCCATTCCTGGATTTAGGAGAGGAACTCAGAAGGCCCTTAGGATGATCTGTTTGTATGGGAAGAAGTTAGAGACAATGGATTTTATAATTCCAGATTTATTGGATAAAAGCTTTGTCATTTTTCAGTATCAGGGAAGTAAGTCATTTAATAGCCTATTTTCCTTAAGAGTGAACTACAGGACAGTAACTATATAAATACATGTTGATTTCTTTTGCAAAACAGTTTTAAGTAATGACATTTTTGCTTTATCAAAATTTTATTCCATCTCTTGGTTTTGTTGTCAACTGCCGAAATGTGCGAAGCTGAAAGACTGTTAGCCCAAGAGCTGTGTGCACTGTGTCTTTAGTGCAGGATTACCTTGTAGGTTCCTAGTCCTCGAGGACTTGCCAGAGTGCTTATAGCCACACCTGGAAGTCAGGAATGTCTCCACATTATTTCAGGGGATTTTAGGGGTCTTGTAGGCTAGTCACAAGGAAGACGACATAACCAAAAGCACAGTAAAGTTTTCGGGTTAGGTTCACTATGGGCTTAACAGCTAGAAGGATTGGGGGGAAAGCTTTAGATTTAAGTAGGATCACCAGCAAACAGCTTTGTTTCAGAATGGCTATAAGTAGGTCTAAATGTCTTCCCAAAAAATTGGTGTGTTTTTTGCCCAGGACAAAAGTCTTAAAGGAAGTTATTTAACTTTTTGTTTTTAAAATGGGCTTATTGTTAATGCCTTATTTATAAAATGTTAAAACAAAATAGAATGTGCTGGGGGTGGGAGCTGGGCGTGTTTTCCAGGGCTGATAACATTGAAAACTGGTTCATCCTCTAGTACTGAGTGGTTTTCAATGGCATGGCTAGTCAGATTCATGATTTTTAAGTATAGGTGTAGATTGGAGCATTTATTACATATTTTACTGTTCAATGTCTTAATGTGGACCTTTTATTTTGTAAATAATTATGGAAATGATTGTGGGGCTTGGAAAAAATTACCTTTGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTTGTCTTAACTAATAAATGTGATTTTTCTCCC