Transcript asmbl_10772

Sequence
Transcript Sequence for observation asmbl_10772 of TGE0035846:
CGGTTTGTTTCGGAACTGAGGCTCAAGCACAGCCGCTCAGGATTGGTGCTAGGCTGGGCCGGGGTCTTTGGCCGGAAGCGGAAGTGGAGAAAGGATGCAGGACCATCAGCACGTGCCCATCGACATCCAGACCAGCAAGCTGCTCGACTGGCTGGTGGACAGAAGACACTGTAACCTAAAATGGCAGAGCCTGGTGCTGACCATCCGGGAAAAAATCAACACTGCCATCCAGGACATGCCAGAGAGCCAGGAGATTGCCCAGCTGCTCTCTGGATCCTACATTCATTACTTCCACTGCCTAAGAATAGTGGACCTTCTTAAAGGCACCGAGGCGTCCACCAAAAATATTTTTGGCCGGTACTCTTCACAACGGATGAAAGATTGGCAGGAGATCGTAAGCCTGTATGAGAAGGACAACACCTATTTAGTGGAACTCTGTAGCCTCCTGGTTCGGAATGTCAGCTATGAGATCCCCTCGCTGAAGAAGCAGATTGCCAAGTGCCAGCAACTGCAGCAAGAATACAGCCGCAAGGAGGAGGAGGGCCAGGCTGGGGCCGCTGAGATGCGAGAGCAATTCTACCACTCCTGCAAACAGTATGGCATCACGGGAGACAATGTCCGAAGAGAACTTCTGGCCCTGGTGAAGGACCTGCCAAGTCAGCTGGCTGAGATAGGGGCAGGGGCTCAGTCCCTGGGGGAGGCCATTGACCTGTACCAGGCCTGTGTGGAGTTTGTGTGTGACAGCCCCACAGAGCAAGTGCTGCCCATGCTGCGGTATGTGCAGAAGAAGGGAAACTCGACGGTGTATGAGTGGAGGACGGGGACAGAGCCCTCTGTGGTGGAGCGACCACAGCTGGAGGAGCCTCCTGAGCAGGTGCAAGAGGATGAGATCGACTGGGGTGACTTTGGGGTGGAAGCTGTTTCCGACTCTGGCATCGTTGCTGAGACTCCTGGAATAGACTGGGGTATCTCCCTGGAGTCAGAGGCCAAGGATGCTGGGGCTGACAAGATAGACTGGGGTGACGATGCTGCTGCTGCTTCAGAGATCACCGTGCTGGAGACAGGAACTGAGGCTCCGGAGGGTGTAGCTCGGGGCTCAGACGCTCTGACTCTTCTGGAATACCCTGAAACTCGGAATCAGTTCATTGATGAGCTCATGGAGCTTGAGATCTTCTTGTCTCAGAGAGCAGTAGAGATGAGCGAGGAGGCCGACATCCTGTCCGTGAGCCAGTTCCAGCTGGCTCCTGCCATCCTCCAGGGCCAGACCAAAGAGAAGATGCTCAGCCTGGTGTCCACGCTGCAGCAGCTGATCGGCCGGCTCACCAGTCTGCGGATGCAGCACCTGTTTATGATTCTGGCCTCGCCAAGGTATGTGGACCGAGTGACAGAGTTCCTCCAGCAGAAGCTGAAGCAGTCGCAGCTGTTGGCTTTGAAGAAGGAGCTGATGGTGGAGAAGCAGCAGGAGGCGCTTCAGGAGCAGGCAGCTCTGGAGCCCAAGCTGGACCTGCTGCTGGAGAAGACCAGAGAGCTGCAGAAACTGATTGAAGCCGACATCTCCAAGAGATACAGTGGCCGTCCTGTGAACCTGATGGGGACCTCTCTGTGACGCGCTCCCTCTGTGTCCTCCACCCTCCTTCCCAGCTACCAGGAGGAGGTGGGACAGCCCAGGCTGATGCTACTGGGCCTCACCAGCAAGAAGTCAGGCGGACTTGGAGACAGAGCCATGAGGAAGGGTCACACCATGATCTCTGCAAGCAGTTGTCTTGAGTGGCTCTGGCCTGTCAGCCTTAAGGCACACTTGCTGCTTCTAGTTGTCAAGTGAGGCTTAATAAAAGGAAGTGACTCTCCTTCGTGGCTGGCAGTCACTTGCACCACCACGCTGAGCCTGCTTGAAGTTGAA