Transcript asmbl_69097

Sequence
Transcript Sequence for observation asmbl_69097 of TGE0000759:
GTAGGAAGTAGGACTATACCACTTTGCCTTACCAAAGGGGTCTAGTTCCTATGTTTTTAAGTTTAAAAACTATTCCCGCTATTAGGCTTTCTATTATCTCGAGTCTTTACACGGGATAAGTAAGTTTAAGGGTGGCAAAAGATGAAAGGACCAGAGGGAATACGGGCGAAAGCAGAGCGAGGGTTGGCCTCTCCCCTTCACAAATAATGGGAGGAACCTGGCAAGAGGGAGTTCTTTCCTTTCGCCGCTGCGGTCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTTGCCTCCAGTGTTCTGCGCTGTGGCAAAAAGAAGGTCTGGTTGGACCCCAATGAGACCAATGAAATTGCCAATGCCAACTCTCGTCAGCAGATTCGGAAGCTGATCAAAGATGGGCTGATCATCCGGAAGCCTGTGACTGTCCATTCCCGAGCACGATGCCGGAAAAACACCTTGGCCCGCAGAAAGGGCAGGCATATGGGCATAGGTAAGCGAAAGGGTACTGCCAATGCTCGAATGCCTGAGAAGGTAACCTGGATGAGGAGGATGAGAATCCTTCGCCGACTGCTCAGAAGATACCGTGAATCTAAGAAGATTGACCGCCACATGTATCACAGCCTGTACCTGAAAGTGAAGGGTAATGTGTTCAAAAACAAGCGGATTCTCATGGAACATATCCACAAGCTGAAGGCAGACAAGGCTCGCAAGAAACTTTTGGCTGACCAAGCTGAGGCCCGTAGATCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGGCTCCAGGCCAAGAAGGAGGAGATCATCAAGACTCTGTCCAAGGAAGAAGAGACCAAGAAATAAAGCACCACCTCTCTTACCTGTACATAGTGGCCTTGGCAATTATATAGATCAATCCTTCAATAAAATAGCTTTCATCTGCCTACCTCTCTGTTCTTCCAAAGTTTCTGGCTGTTTGATGAGTCTTCACTATTTAGAGGGCCAGAACTGAGCACACCGAGTTCTGAGATGCAGACCCTCTCCAGAGTGCCAGTTTTCATTCTTTCCTTGGCTCCTGGCCTCTGATAAGGCTCATGACCCCTCTGTCCATGGAAGAGACGGTTTTTTTACCTTGTTTTAGTGGGATGTGGGGCTTACTTTGAAGGGAGGGAAGGAATGACTTCTACTCAACTTCCGAAGTGCTGTGCTTTAAACTGCCTTTTACAGTAGAGCGTGAGTGGCATTTCAGAAGTGGTCTCAGATGTTGGTTGGGAACCAATAGTTGTGACATCAGCTGTCATTGTTTTAAAAACAAAAAACAGAATGCTTACACTTTTCAACTGGGCACTGGGGTCCAAGGTTGAAATCTGCCCTAGAACTCAAGGACAGTGAGAGTTTCAACCACCTCCAGTCAAGCTAATGACACCTGGACTTCACTGACTGCTACCTATGCTTTCTCTAAACAACTTTATTGAAGCTGTCATTTTGAACATTCCAGTTTCTAAACCTTTATGTCCTATCAGGGTTTTGTTTTTTGTTTTCTGTTTTACACTGATAGATTACAAAGAGAAAGGCTTTTCTCAGAAATTGGAATAAAGGCACGCAACAAAAACTGGTCAGCCATTGTGAGTTGCTTAATGAAT