Transcript asmbl_9029

Sequence
Transcript Sequence for observation asmbl_9029 of TGE0001383:
CCGGCGGCCATTTTGGGTGGAAGCGATCACTGAGTGGCGGCGGCTGCTGATTGTGTTCTAAGGGTCGGAGTGGGGTCGACGTTTGCTCTACCGGAACAGCTTAGCTCATTCCTCCCTTTCCATTACCTGTGGCGCGGAGAGTTGGGGCGGCGGCTGCGTCAGCAAGGGCGGTGGTGGCGGCGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGATTCTGGGGTTGGAAAGTCCTGCCTTCTCCTTAGGTTTGCAGATGATACGTATACGGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAGATACGAACTATAGAGTTAGATGGGAAAACAATCAAGCTACAGATATGGGACACAGCAGGCCAGGAAAGATTTCGAACAATCACTTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAACGTTAAACAGTGGCTGCAGGAGATAGATCGCTACGCCAGTGAAAATGTCAACAAGTTGTTGGTAGGGAACAAATGTGACCTGACCACAAAGAAAGTAGTAGACTACACAACAGCAAAGGAATTTGCAGATTCCCTTGGAATTCCATTTTTGGAAACCAGTGCTAAGAACGCAACGAATGTAGAACAGTCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCTGGAGCTACAGCTGGTGGTGCCGAGAAGTCCAATGTTAAAATCCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGCTGCTGCTAAAATCTGCCTCCGTCCTTTTCTCACAGCAATGAATTCGCAATCTGAACCCAAGTGAAAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTTTCCACAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTTATTCCCTTGACTCAAGACCGCTAACTTCATTTTCAGAACTGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGATCGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTATATTGGCATGTTTAGATGTTGGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCACACAGCACAACCAGTGTCTGTCAGTTTCCACGCATAAAGTTTAGTGAGACGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTGGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACTGTATGGTGATAAGTATTGTTTTAATTCCTATGATTAAAGGGAAATAGAGCTTTGCATTCTACTCAGCAGCCACGTGTGTGCAGCAAGGGCACTGTAGACCTATCTTAATAGCACAGCATCCAGGGTTTGCTTTCTAGTAATAGGTCTGATGAGTGACCTAGAGAAGCTTTTGTGCTGTGTAGAGACTTCACCACCTTCATTGGTTCAAGGAACTCAAACTCTAGTGCTTCATCTCCAGCCCAGGCCACCTGAAGTGGCTTCACCAGCAACCCTTTTTTCCCTCATCTGTGGTAGAGATGGAGAGCAGCCCATGCTTCCTCCCAGGCAGTGATCTGGTAATAGTGCTGGTGTTTCTTCATGCTCAGTCTGATGGCGCACACACCTTTTTCTTTCTTTTTTCTTTTTGGCTATTGGAGATAGGGTTTCTCTGTGTATCCCTGGC