Transcript asmbl_69067

Sequence
Transcript Sequence for observation asmbl_69067 of TGE0007325:
CGCTGGGAAGGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCGAGCCCGCGCTCGTGTGCAGGCCCGGCTTGGTTCCTGGTCTCTGGTGCGAGGGTTCACACGAGGCCCCGGCCTCGGACCCCGGACTAGGCCGCGACCCCGGGCGCCATGAAGCAGGAGGGCTCGGCGCGGCGCCGAGGGGCGGACAAGGCGAAACCGCCACCCGGCGGAGGGGAACAAGAACCACCGCCACCCCCGGCCCCCCAGGATGTGGAGATGAAAGAGGAGGCGGTGGCAGGTGGCGGATCAACGGGGGAGGCTGACGGCAAGACGGCGGCGGCGGCGGCTGAGCACTCCCAGCGAGAGCTGGACACCGTCACCTTGGAGGATATCAAGGAGCATGTGAAACAGCTGGAGAAGGCAGTTTCAGGCAAGGAGCCTCGATTTGTTCTGAGGGCCCTGCGGATGCTGCCTTCCACATCACGCCGCCTCAACCACTATGTTCTGTATAAGGCTGTGCATGGCTTCTTCACCTCAAATAATGCCACTCGGGACTTCTTGCTACCCTTCCTGGAAGAGCCCATGGACACAGAAGCTGATTTACAGTTCCGTCCCCGAACAGGAAAAGCTGCATCAGCACCGCTGCTGCCTGAAGTGGAAGCCTATCTGCAGCTCCTCATGGTCATCTTCCTGATGAACAGCAAGCGCTACAAAGAGGCACAGAAGATCTCTGATGATCTGATGCAGAAGATCAGCACTCAGAACCGCCGGGCCCTGGACCTTGTGGCTGCAAAGTGTTACTACTACCACGCCCGGATCTATGAGTTCCTGGACAAGCTGGATGTGGTGCGCAGCTTCTTGCATGCACGGCTCCGGACAGCCACCCTTCGGCATGACGCAGACGGGCAGGCCACCCTGCTTAACCTTCTGCTGCGGAACTACCTACACTACAACTTGTACGACCAGGCTGAGAAGCTGGTGTCCAAGTCCGTGTTCCCTGAGCAGGCCAACAACAATGAGTGGGCAAGGTACCTCTACTACACAGGGCGGATCAAAGCCATCCAGTTGGAGTACTCAGAGGCCCGGAGAACAATGACCAATGCCCTTCGCAAGGCCCCTCAGCACACAGCTGTCGGCTTCAAACAGACTGTGCACAAGCTTCTTATTGTGGTGGAGCTGTTGCTGGGGGAGATCCCGGACCGACTGCAGTTCCGTCAGCCATCCCTCAAGCGCTCGCTCATGCCCTACTTCCTTTTGACCCAAGCTGTCAGGACAGGAAACCTAGCCAAGTTCAACCAGGTCCTGGATCAGTTTGGGGAGAAGTTTCAAGCAGATGGGACCTACACCCTAATCATCCGACTGCGGCACAACGTCATTAAGACAGGTGTGCGCATGATCAGTCTCTCCTATTCCCGAATCTCCCTGGCCGACATCGCCCAGAAGCTGCAACTAGATAGCCCAGAGGATGCAGAGTTCATTGTTGCCAAGGCCATCCGGGATGGCGTCATTGAGGCCAGCATCAACCATGAGAAGGGCTACGTGCAGTCCAAGGAAATGATTGATATCTATTCCACGCGTGAGCCCCAGCTCGCCTTCCACCAGCGCATCTCCTTCTGCCTAGACATCCACAACATGTCTGTCAAGGCCATGAGGTTTCCTCCCAAATCATACAACAAGGACTTGGAATCTGCAGAGGAACGGCGTGAGCGAGAGCAGCAAGACTTGGAGTTTGCCAAAGAGATGGCAGAAGATGATGATGACAGCTTCCCTTGAGCTGGGGGGCTGGGGAGGGGTGGGGTGAGTGGGGACTGGCTCTTTATCTTTCCCCTCAGGGGTCCCATGCCCAGGGAACTGGCCCTTTTTCCCACACACAGCTCACAGACTGCATATGTGCTGGGGGCGGGCGGGGTGAAGGGTGTAGAGAGCCAGCCACCCCCACCTCACCTCAGGGCCCCTCCCCAGCCGGTGATTTAGCACACAGTGGTCAAGAGGGCGGGCAGACAGCCTCCCCAGGGCAGGGTCCTGGCTAGTGGTGTGGGCAGCAAGATGGGAGGGAAAAGCCCTGTGCTCTCCTCCAGGGAGTAGGGGACTGGAACTGGGACATGTGTCGGGTTGTATGTTTTTTGAAGCTTCAATTATGATTTTTAAACAATAAAAGTTCTCCAAAGCA