Transcript asmbl_69041

Sequence
Transcript Sequence for observation asmbl_69041 of TGE0007322:
GCCCCAGTCACTGAGCCGCCGCCGAGGACTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTCCCGACGCTCCGTCCCCCCTGCCCGCCTTCTCCCGCCGCCGCCTTCCGCAGGCCGTTTCCACCGAGGAAAAGGAATCGTATCGTATGTCCGCTATCCAGAACCTCCACTCTTTCGACCCCTTTGCTGATGCAAGTAAGGGTGATGATCTGCTTCCTGCTGGCACTGAGGATTATATCCATATAAGAATTCAACAGAGAAACGGCAGGAAGACCCTTACTACTGTCCAAGGGATCGCTGATGATTACGATAAAAAGAAACTAGTGAAGGCGTTTAAGAAGAAATTTGCCTGCAATGGTACTGTAATTGAGCATCCAGAATATGGAGAAGTAATTCAGCTACAGGGTGACCAGCGCAAGAACATATGCCAGTTCCTCGTAGAGATTGGTCTGGCTAAGGACGACCAGCTGAAGGTTCATGGGTTTTAAGTGCTTTTTGGCTCACTGAAGCTTAAGTGAGGATTTCCTTGCAATGAGTAGAATTTCCCTTCTGTCCCTTGTCACAAGTTTAAAAACCTCACAGCTTGTATAATGTAACCATTTGGGGTCTGCTTTTAACTTGGACTAGTGTAACTCCTTCATGCAATAAACTGAAAAGAGCCATGCTGTCTAGTCTTGAAGTCCCTCATTTAAACAGAGGTCAAGCAGTAGGCACCCGGCAGTGTCCAGCCTGAAACAAAGCAATAACGTGATGTTTCGGCCAAGCTCAGAGCCCCAAGATCACAGATGGCTATGTCCAGCCAGAAGCTCCTCGGCTCTCCCTCTACAGAATTCCCTGCCCTAAGAGAATGTCACCACCTGAACAGCCTTCGGTGAAGCTTGAGAGAGGATGGGGTAAGGCAGCAACAGCAGCTGTGCCACTAGAGGGAGCCTCCAGTAGTCAAAGATCCCTTGGTGTCTCCAATCTGACCAGGTGGGTGGAGCTTCAGGCAGTCACCTTCCCGCTGTTGAGGTGATAAGGACACCTGGCTTGCCACCAAGGTGTTTTTGATAAGAAATGTCCTAACCGATGTCCAAACACAGAATGTGAGGCCAACCTTCTATCAGAGTTAAACTTTTGACAAGGGAACAAGTTTCAAACTGATGTGTCATGTAGCTAGCTGTAGAGCTTGCAGTTTACTAGCAAGAGCTGCCCAATGCCATGTGAAGTAACAGATTTTTGGTTTTTTCCCTTCAGTTTTAATGTTATGTAATGTATTTAAACCCTTATTTAAATAAAACTTGTTTTCAGAAA