Transcript asmbl_6717

Sequence
Transcript Sequence for observation asmbl_6717 of TGE0041829:
CTTTCTGCCATCTTCCTTCGCCGCCACCATGGTGTGAATGAATGTTCTGGCGGATGCTCTCAAGAGCATCAACAACGCTGAGAAGAGAGGCAAACGCCAGGTCCTCATCAGGCCATGTTCTAAAGTCATCGTTCGGTTCTTAACTGTGATGATGAAGCACGGATACATTGGTGAATTCGAGATCATTGATGGTCACAGAGCTGGGAAGATTGTTGTGAACCTCACAGGAAGGTTGAACAAGTGTGGCGTTATAAGCCCTAGATTTGATGTTCAACTCAAAGACCTAGAGAAATGGCAGAACAACCTGCTCCCTTCACGTCAGTTTGGCCTCATTGTGCTGACAACCTCGGCTGGCATTATGGACCATGAAGAGGCAAGACGAAAACATACAGGAGGGAAAATCCTGGGATTCTTTTTTTAAATGTAAAGCATAAATAAAAAGCCTTTGTGGACTGTGAAAAAAAAA