Transcript asmbl_10710

Sequence
Transcript Sequence for observation asmbl_10710 of TGE0000008:
CCCCTTTGTGCGTCACGGGTGGCGGGCGCGGGAAGGGGATTTGGATTGTTGCGCCTCTGCTCTGAAGAAAGTGCTGTCTGGCTCCAACTCCAGTTCTTTCCCCTGAGCAGCGCCTGGAACCTAACCCTTCCCACTCTGTCACCTTCTCGATCCCGCCGGCGCTTTAGAGCCGCAGTCCAGTCTTGGATCCTTCAGAGCCTCAGCCACTAGCTGCGATGCATGTGATCAAGCGAGATGGCCGCCAAGAACGAGTCATGTTTGACAAAATTACATCTCGAATCCAGAAGCTTTGTTATGGACTCAATATGGATTTTGTTGATCCTGCTCAGATCACCATGAAAGTAATCCAAGGCTTGTACAGTGGGGTCACCACAGTGGAACTAGATACTTTGGCTGCTGAAACAGCTGCAACCTTGACTACTAAGCACCCTGACTATGCTATCCTGGCAGCCAGGATCGCTGTCTCTAACTTGCACAAAGAAACAAAGAAAGTGTTCAGTGATGTGATGGAAGACCTCTATAACTACATAAATCCACATAATGGCAAACACTCTCCCATGGTGGCCAAGTCAACATTGGATATTGTTCTGGCCAATAAAGATCGCCTGAATTCTGCTATTATCTATGACCGAGATTTCTCTTACAATTACTTCGGCTTTAAGACGCTAGAGCGGTCTTATTTGTTGAAGATCAATGGAAAAGTGGCTGAAAGACCACAACATATGTTGATGAGAGTATCTGTTGGGATCCACAAAGAAGACATTGATGCAGCAATTGAAACATATAATCTTCTTTCTGAGAGGTGGTTTACTCATGCTTCGCCCACTCTCTTCAATGCTGGTACCAACCGCCCACAACTTTCTAGCTGTTTTCTTCTGAGTATGAAAGATGACAGCATTGAAGGCATTTATGACACTCTAAAGCAATGTGCATTGATTTCTAAGTCTGCTGGAGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCTACTGGCAGCTACATTGCTGGGACTAATGGCAATTCCAATGGCCTTGTACCGATGCTGAGAGTATATAACAACACAGCTCGATATGTGGATCAAGGTGGGAACAAGCGTCCTGGGGCATTTGCTATTTACCTGGAGCCTTGGCATTTAGACATCTTTGAATTCCTTGATTTAAAGAAGAACACAGGAAAGGAAGAGCAGCGTGCCAGAGATCTTTTCTTTGCTCTTTGGATTCCGGATCTCTTCATGAAACGAGTGGAGACTAATCAGGACTGGTCTTTGATGTGTCCAAATGAGTGTCCTGGTCTGGATGAGGTTTGGGGAGAGGAATTTGAGAAACTATATGCAAGTTATGAGAAACAAGGTCGTGTCCGCAAAGTTGTAAAAGCTCAGCAGCTTTGGTATGCCATCATTGAGTCTCAGACGGAAACAGGCACCCCGTATATGCTCTACAAAGATTCCTGTAATCGAAAGAGCAACCAGCAGAACCTGGGAACCATCAAATGCAGCAACCTGTGCACAGAAATAGTGGAGTACACCAGCAAAGATGAGGTTGCTGTTTGTAATTTGGCTTCCCTGGCCCTGAATATGTATGTCACATCAGAACACACATACGACTTTAAGAAGTTGGCTGAAGTCACTAAAGTCGTTGTCCGAAACTTGAATAAAATTATTGATATAAACTACTATCCTGTACCAGAGGCATGCCTATCAAATAAACGCCATCGCCCCATTGGAATTGGGGTACAAGGTCTGGCAGATGCTTTTATCCTGATGAGATACCCTTTTGAGAGTGCAGAAGCCCAGTTACTGAATAAGCAGATCTTTGAAACTATTTATTATGGTGCTCTGGAAGCCAGCTGTGACCTTGCCAAGGAGCAGGGCCCATACGAAACCTATGAGGGCTCTCCAGTTAGCAAAGGAATTCTTCAGTATGATATGTGGAATGTTACTCCTACAGACCTATGGGACTGGAAGGTTCTCAAGGAGAAGATTGCAAAGTATGGTATAAGAAACAGTTTACTTATTGCCCCGATGCCTACAGCTTCCACTGCTCAGATCCTGGGGAATAATGAGTCCATTGAACCTTACACCAGCAACATCTATACTCGCAGAGTCTTGTCAGGAGAATTTCAGATTGTAAATCCTCACTTATTGAAAGATCTTACCGAGCGGGGCCTATGGCATGAAGAGATGAAAAACCAGATTATTGCATGCAATGGCTCTATTCAGAGCATACCAGAAATTCCTGATGACCTGAAGCAACTTTATAAAACTGTGTGGGAAATCTCTCAGAAAACTGTTCTCAAGATGGCAGCTGAGAGAGGTGCTTTCATTGATCAAAGCCAATCTTTGAACATCCACATTGCTGAGCCTAACTATGGCAAACTCACTAGTATGCACTTCTACGGCTGGAAGCAGGGTTTGAAGACTGGGATGTATTATTTAAGGACAAGACCAGCGGCTAATCCAATCCAGTTCACTCTAAATAAGGAGAAGCTAAAAGATAAAGAAAAGGTATCAAAAGAGGAAGAAGAGAAGGAGAGGAACACAGCAGCCATGGTGTGCTCTTTGGAGAATAGAGATGAATGTCTGATGTGTGGATCCTGAGGAAAGACTTGGAAGAGACCAGCATGTCTTCAGTAGCCAAACTACTTCTTGAGCATAGATAGGTATAGTGGGTTTGCTTGAGGTGGTAAGGCTTTGCTGGACCCTGTTGCAGGCAAAAGGAGTAATTGATTTAAAGTACTGTTAATGATGATAATGATTTTTTTTTTAAACTCATATATTGGGATTTTCACCAAAATAATGCTTTTGAAAAAAAGAAAAAAAAAACGGATATATTGAGAATCAAAGTAGAAGTTTTAGGAATGCAAAATAAGTCATCTTGCATACAGGGAGTGGTTAAGTAAGGTTTCATCACCCCTTTAGCACTGCTTTTCTGAAGACTTCAGTTTTGTTAAGGAGATTTAGTTTTACTGCTTTGACTGGTGGGTCTCTAGAAGCAAAACTGAGTGATAACTCATGAGAAGTACTGATAGGACCTTTATCTGGATATGGTCCTATAGGTTATTCTGAAATAAAGATAAACATTTCTAAGTGA