Transcript asmbl_68838

Sequence
Transcript Sequence for observation asmbl_68838 of TGE0007278:
GTGGGTCTGCTGCGCGCTGCGCTGGTCGCGAACCGCGGCCCGGCTGCGGCCGGGGCTGCTGCTCTCTGCGGGCCGCTGCTCGCCTGCGGCCGCCTCCTACTCTGCTTCTGCCGAGCCCTCCCAGGTCCAGGCGCTGGTCTACGAGCACCACGGGCACCCAACCAAGGCCATCGAACTGAAGAACCTGGAGCTAACTGCTGTGGGCGGATCAGATGTCCATGTGAAGATGCTGGCGGCCCCTATCAATCCATCTGACATAAATATGATCCAAGGGAATTATGGCTTCCTTCCCAAGCTACCTGCCATTGGAGGAAACGAAGGCGTTGGACAGGTGGTCGCAGTGGGCAGCAGTGTGACTAGGGTGAAGCCAGGAGACTGGGTGATTCTAGCACATGCCGGTTTGGGAACCTGGCGGACCGAGGCTGTGTTCAGCGAGGAAGCACTGATCAGAGTTCCGAGTGACATCCCTCTTCAAACTGCTGCCACCCTGAGTGTCAATCCCTGCACAGCCTACAGGATGTTGATGGACTTTGAGCAGCTGCAGCCAGGGGATTCTGTCATCCAGAATGCATCCAACAGTGGAGTAGGGCAAGCAGTCATCCAGATCGCCGCAGCCCTGGGCCTGAGGACCATCAATGTGGTCCGAGACAGACCTGACATCCATAGGCTGACTGACAGACTGAAGAATCTAGGGGCTGAGTATGTAATCACAGAAGAAGAGCTAAGAAAACTTGAGCTGAAAAACTTCTTTAAGGATGTGCCCCGGCCCCGGCTTGCTCTCAACTGCGTCGGTGGGAAAAGCTCCACCGAGCTGCTGCAGCGCTTGGCGCCCGGAGGAACCATGGTGACCTACGGGGGCATGGCCAAGCAGCCCGTCATCGCTTCTGTGAGCGTGTTCATTTTTAAAGATGTCAAACTTCGGGGCTTTTGGCTATCCCAGTGGAAGAAGGACCACAGTACAGACCATTTTAAGGAGCTGATCCTTACACTGTGCCACCTCGTCCACCAAGGCAAGCTCACAGCCCCCACCTGCTCCGAGGTCCCACTGCAGGACTACAACCATGCCTTGGAAACCGCAATGCATCCCTTCACATCGTCAAAGCAGATTTTCATCATGTGATAATAATCCCAGAGGAGCCAGAGCAAAGTGCGGGGCAGGGGGCAGAAGGGTGTGGGGGCGGGACGGGTCAGCAGGACACGTTTTGGCTCCTCAGTCAAGGCTCTTGACATTCCCCAGGCTGCTCCTCTCCTCAATGTCTGTTCCCACTAGAAGAGCTGTGAAGCCAACCAAGGCTTTCCCCAGGGTCAGCCTCGGGATATCTAATAAAGTCTAAACTTCTTAAACACAACAGACAAAAACCAGTAGAAGTCATCTCTGTCGAAAAGGACTATCACCGCACACCTGTCATCTCCCAGGACTAAGAAGTCCCCCTTCTTGCCTGTCCTCCATTCGTCCCTAGTAATCATTTCCTGATACCCTG