Transcript asmbl_68484

Sequence
Transcript Sequence for observation asmbl_68484 of TGE0007233:
GCGGGGGCGAGGTTCGGGCCGGTTGTGCCGTTGCGAGACTGCAGCTGCGATCGCTGCGGTGGGCCCAGAATTGTATCCTGACCGTAAATCGGAGAAGCCAGCAGCACTGCCAGTGTTCCTTTGAGGTAGTGTCTGGGATCCGGTGCAAGTTGAATCATTGTTCAAATAAGGTGTAATTGAAAAGTGACTGACCCTCTCTTCAGAGATGTCAAAAACAAACAAATCCAAGTCTGGATCTCGTTCTTCTCGCTCGAGGTCTGCATCAAGATCTCGTTCTCGTTCATTTTCGAAGTCTCGATCTCGAAGTCGATCTGTCTCTCGTTCAAGGAAGCGCAGGCTGAGTTCTAGGTCTCGTTCCAGATCATATTCTCCAGCTCATAACAGAGAGAGGAATCATCCAAGAGTATATCAGAATCGGGATTTCCGAGGGCACAACAGAGGTTATAGAAGGCCTTATTATTTCCGTGGGCGCAACAGAGGCTTTTATCCGTGGGGCCAGTATAACCGAGGAGGTTATGGAAACTACCGCTCAAATTGGCAGAATTACCGGCAAGCATACAGTCCTCGTCGGGGCCGTTCCCGATCCCGGTCCCCAAAGAGAAGGTCCCCTTCGCCACGGTCCAGGAGCCATTCTAGAAACTCCGATAAGTCTTCTTCTGACAGGTCAAGGCGCTCCTCATCCTCTCGTTCTTCCTCCAACCACAGCCGAGTTGAATCTTCTAAGCGCAAATCTGCAAAGGAGAAAAAGTCCTCTTCCAAGGATAGCCGGCCGTCTCAGGCTGCTGGGGAAAACCAGGGAGATGAAGCCAAGGAGCAGACGTTCTCTGGAGGCACTTCTCAAGATTCGAAAGCATCTGAAAGCTCTAAGCCATGGGCAGATGCCAGCACATACAGTGCTGGTTCTGCATCACGGGCCTCGGCAGTTTCCGAGCTGAGTCCCCGGGAGCGAAGCCCTGCTCTGAAAAGCCCCCTCCAGTCTGTGGTGGTGAGACGGCGGTCTCCCCGTCCCAGCCCTGTGCCCAAACCTAGCCCTCCACTTTCCAGCACATCCCAGATGGGTTCAGCTCTGCAGAGTGGTTCTGGGTACCAGGCTGGGACACACCAAGGTCAATTTGACCATGGCTCTGGGTCCTTGAGTCCATCCAAAAAGAGCCCTGTGGGTAAGAGTCCACCAGCCACTGGCTCCACATATGGCTCGTCTCAGAAAGAGGAGGCCGCTGCTCCAGGAGGAGCAGCCTATACAAAGAGGTATCTAGATGAACAGAAGACAGAGAATGGAAAAGATAAGGAACAGAAACAAACAAATACTGATAAAGAGAAAATGAAAGAGAAAGGGAGCTTCTCTGACACAGGCTTGGGTGATTCGAAAATGAAATCTGATCTGTTTGCTCCCAAAACTGATTCTGAGAAGCCTTTTCGGGGTAGCCAGTCTCCCAAAAGATATAAGCTCCGAGATGACTTTGAGAAGAAGATGGCTGACTTCCATAAGGAGGAGATGGATGATCAAGACAAGGACAAAGCTAAAGGAAGGAAGGAATCTGAGTTTGATGATGAACCCAAATTTATGTCGAAAGTCATCGCAGGTGCAAACAAAAACCAGGAGGAGGAGAAGTCAGGCAAATGGGAGGGCCTGGTATATGCACCCCCAGGGAAGGAAAAGCAGAGGAAAACGGAGGAGCTGGAGGAGGAGTCTTTCTCAGAGAGATCCAAAAAGGAAGATCGGGGAGGGCCCAAGAGAACCGAAAGTGGGCACAGGGGGTTTGTGCCTGAAAAGAATTTCCGAGTGACCGCTTACAAAGCAGCCCAGGAGAAAAGTTCATCTCCTCCCCCAAGAAAGACCTCGGAGAGCCGAGAGAAGCTGGGAGCCAAAGGAGACTTTTCCACAGGGAAGTCATCCTTTTCCATTACTCGAGAGGCCCAGGTCAATGTCCGGATGGATTCTTTTGATGAAGACCTTGCAAGACCCAGTGGGTTATTGGCCCAGGAACGCAAGCTTTGTCGGGATCTAGTCCATAGTAACAAAAAGGAACAGGAATTTCGTTCCATTTTCCAGCACATACAGTCAGCTCAGTCTCAGCGGAGCCCCTCAGAACTCTTTGCCCAGCACATAGTGACCATTGTTCACCATGTAAAAGAGCATCACTTTGGGTCCTCAGGAATGACATTGCATGAACGCTTTACTAAATACCTAAAGAGAGGAACTGAGCAGGAGGCAGCTAAAAACAAGAAAAGCCCAGAGATACACAGGAGGATAGACATTTCCCCCAGTACATTCAGAAAACATGGTTTGGCTCATGATGAAATGAAAAGCCCTCGGGAACCTGGCTACAAGGATGGGCATAATTCTAAAAATGAACTACAAAGGGTTAATTTTTATTAAATGTATCAACAACCTTTGTGAAGTGGTTAGAATATGGTAAATGACCCCAAAGTCTATTGAGGTGAGCTTGAGAAAAAAAAGAGAGGAGTTTTGGAACAAGTGCCCATGATGAGAGAAGAAACTTTTTGTGATATTTTTCTGCTTGCTGAGGGAAAATACAAAGATGATCCTGTTGATCTCCGCCTTGATATTGAACGGCGTAAAAAACATAAGGAGAGAGATCTTAAACGAGGCAAATCAAGAGAATCGGTGGATTCCAGAGACTCAAGCCACTCGAGGGAAAGATCAGCTGAGAAAACCGAGAAACCCCATAAAGGATCAAAGAAGCAGAAGAAGCACCGGAGAGCACGAGACCGGTCCAGGTCATCATCCTCTTCCTCCCAGTCATCCCACTCCTACAAAGCGGAGGAGTACACTGAAGAGACGGAGGAGAGAGAGGAGAGCACCACGGGCTTTGACAAATCGAGACTGGGGACCAAAGACTTCGTGGGTCCAAGTGAAAGAGGCAGAGCTCGAGGGGCCTTTCAATTTCGAGCCAGAGGGAGAGGCTGGGGCAGAGGCAACTACTCTGGCAACAACAACAGCAGCAGCAACAATGATTTTCAAAAGAGAAACCGGGAGGAGGAATGGGACCCTGAGTACACACCGAAAAGCAAGAAGTATTACCTGCATGACGACCGGGAAGGAGAAGGCAGTGAGAAGTGGGTGAGCCGGGGCCGTGGCCGAGGAGCCTTTCCCCGAGGTCGAGGCCGGTTCATGTTCCGGAAATCCAGCACCAGCCCTAAATGGGCCCATGACAAGTTCAGTGGGGAAGAAGGCGAGATTGAAGATGACGAGAGTGGGACAGAGAACCGAGAAGAGAAGGACAATTTACAGCCCACCACTGAGTAGGGGCCACTCTCATGAGAACCCTTGCCCAGGGGAACAGAGGCGCTGGGAAGATGGCTGGTGAAAAGCTAAACAGATGAGCCCCAAGAAGATTCTGATGAGCCCCAACCCTACCCCCCACCAGCCATGCAGAATCCTACTACAGCCAAAAGCATCCTTGGCGCTGTGTCCCACTGGACAGAGGTGGCCGGCCATGGAGCCTGGGGTCAGGCCCAGCTCTTGAGCAGAATACAACACTTTGGGCTTTAGCTGTGTTTCTCATTTGTTGTTGGTGTGTGGGGTGG