Transcript asmbl_4912

Sequence
Transcript Sequence for observation asmbl_4912 of TGE0001085:
TAACTGCGCAAGCGCAGCCCGTACTTCCTTTTCCGAGTAACCGCCAAGATGGCCGAAGTGGAGCAGAAGAAGAAGCGCACCTTCCGCAAGTTCACCTACCGTGGCGTAGACCTCGACCAACTGCTCGACATGTCCTATGAGCAACTGATGCAGCTGTACAGCGCCCGCCAGAGGAGGCGCCTGAACCGTGGTCTTCGGCGGAAGCAACACTCACTGCTCAAGCGCTTGAGAAAGGCCAAAAAGGAGGCACCACCCATGGAGAAGCCTGAGGTGGTGAAGACGCACCTGAGGGACATGATCATCCTGCCGGAGATGGTGGGTAGCATGGTGGGCGTGTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAACCAGAGATGATCGGCCACTACCTGGGCGAGTTCTCCATCACCTACAAACCCGTGAAGCACGGCCGGCCCGGGATCGGTGCCACCCACTCCTCCCGATTCATCCCCCTCAAGTAGCCGAGGCCAATAAAGACTGGTTTTGGTCCCTGG