Transcript asmbl_48561

Sequence
Transcript Sequence for observation asmbl_48561 of TGE0001056:
CGGAAGTCCCGCCCTTCTCGCCCTGTACGCCAAAGGCTGGAGCAACGCGCTTGGAGGCGGGAGTGATCTGCGAGCGAAACCTACACCATGAGTCTCCTCAATAAACCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGAGGAATTCAACACAGGTCCCCTCTCAGTGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAACAAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAAAATGTGAAGGAGATGTGGACTGAGGTTCCCAAGAGCGGCAAGGGCAAGAAGAAATCCAAGCCTGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTGCTGCGGAACCCACTCATCGCTGGCAAGTAGAGCCTGCTCCCTGCCCTGCGAAGGCCTGCAGAACCCTGCCCAGTGGGCGAGAAATAAAACCCTGTGCTTTTTGGTTTTTATGTTT