Transcript asmbl_48474

Sequence
Transcript Sequence for observation asmbl_48474 of TGE0005446:
TTTGTCAGCCTGACCAAACCCTGATGAATTTTTGGCCCTTTGTAGGTAAAAGAGCTGCTGACATCCTTTGGGCCTCTCAAGGCCTTCAACTTGGTTAAGGATAGTGCCACAGGGCTCTCCAAGGGCTATGCCTTCTGTGAGTACGTGGACATCAACGTCACAGATCAGGCCATTGCGGGGCTGAATGGGATGCAGCTAGGGGACAAGAAGCTGCTTGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAATCAGACACCTGTGACCCTTCAAGTGCCCGGCCTGATGAGCTCTCAGGTGCAGATGGGCGGTCACCCAACTGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGATGAGGAGTATGAGGAGATTGTAGAGGACGTACGAGACGAGTGCAGCAAGTATGGGTTGGTCAAATCCATTGAAATTCCCCGCCCCGTGGACGGCGTCGAGGTGCCTGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGTCTAACCGGTCGCAAGTTCGCCAACAGAGTGGTGGTCACAAAATACTGTGACCCTGATTCTTACCACCGTCGGGACTTCTGGTAGAGGTGGCTGGGGGAGGGTGGGGGCAGGGC