Transcript asmbl_48203

Sequence
Transcript Sequence for observation asmbl_48203 of TGE0009200:
GCATACTTCTGTCCCACGGAGGTTCAAGGACTACCTCATGTCCTCCCTCCCTCCAAAAAAGGTCAGGAATTGGGCTGGGCTGGCCTGGCTGTGGTGACCCTGGTCTTCTCCTGTCTCCAGAGAAATCTTGGTAGAAGAGAGCAACGTGCAGAGGGTGGACTCGCCAGTCACAGTATGCGGTGACATCCATGGACAATTCTATGACCTCAAGGAGCTGTTCAGAGTAGGTGGCGATGTCCCTGAGACCAACTACCTCTTCATGGGAGACTTTGTGGACCGTGGTTTCTACAGTGTTGAAACCTTCCTCCTCCTGCTGGCTCTTAAGGTTCGCTATCCTGACAGAATCACTTTGATCCGGGGCAATCATGAGAGTCGCCAGATTACCCAGGTCTATGGGTTCTATGATGAGTGCTTACGGAAATATGGTTCAGTGACTGTATGGCGCTACTGTACTGAGATCTTTGACTACCTCAGCCTGTCTGCCATCATTGATGGCAAGATCTTCTGTGTGCATGGAGGTCTTTCCCCTTCCATCCAGACCTTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTACCCCATGATGGACCCATGTGCGACCTCCTGTGGTCTGACCCTGAAGACACAACAGGCTGGGGAGTGAGCCCCCGCGGGGCAGGTTACCTGTTTGGCAGTGACGTGGTCGCCCAGTTCAATGCAGCCAACGACATTGATATGATCTGCCGTGCCCACCAATTAGTGATGGAAGGCTACAAGTGGCACTTCAATGAGACCGTGCTTACTGTGTGGTCAGCGCCTAATTACTGCTACCGCTGTGGCAATGTGGCAGCCATCTTAGAACTGGATGAGCACCTCCAGAAAGATTTCATCATCTTCGAGGCTGCACCCCAAGAGACACGTGGCATCCCCTCCAAAAAGCCAGTGGCCGACTATTTCCTGTGACTCCTTGGCCCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTGCCCAGTCGGAGGCTGGGTCTGAGGGGCTGCCTGGCTTTGCTTGCCCCAGGGTGCGGACTTGCTCTGGAGAGGTGGAGCCTTGGCTCCTGGCTTCCTCTCCTTTCTCCCACTTGATCCATGAAGTTTTCAGTCATTTTTTTTTTCTTTTTTCCTTTTTTTTCCTTTCTTTTTTCTTTTTGTTTTTGTTTTTAGATAAAACATTTTGAGAAAAAAAGAAAAAAATTCTAATAAAAGAAGAAAAATA