Transcript asmbl_67479

Sequence
Transcript Sequence for observation asmbl_67479 of TGE0007200:
GGGGACGCGTGTAGGACCCGGATGCAGACGCGAGCACAGGTTTATAAGCGCCACGCAGGCCACGGTCCCTTCTTTTGGAGGAAGACGCGGTAGCAGCTTCAGCTGCGTTTCGTCTTGCTCGCTGTTGCTCCTGACTCACCGCTGTTCGCTCTCGTGGAGGAACAAGTCGGTCAGGAAGCCGCGCTGCAGCCATGGCCTTTAAAGATACCGGAAAGACGCCCGTGGAACCAGAGGTGGCGATTCACCGAATTAGAATTACTTTGACCAGCCGCAACGTAAAATCTTTGGAGAAGGTGTGTGCTGATTTGATCAGAGGTGCGAAGGACAAGAATCTCAAAGTGAAAGGACCAGTTCGGATGCCCACCAAGACTCTGAGAATCACTACAAGAAAAACTCCCTGTGGAGAAGGTTCTAAGACTTGGGATCGTTTTCAGATGAGGATCCACAAGCGACTCATTGACTTGCACAGCCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTTGAAGTCACCATTGCAGATGCTTAAATCAGACTTTTTAATAAATTGACTATCAGTTAAATTTTGTTGACTTTTATTTGCAGTAATGGCACATTTTAAGACTATAAATTTAGACTGAATTTACTTTCAAGTAGAATAATCAAAATTAGTTGGATATGCTGTGGTAACCTGTCCTGTTTTCATTATATTCTGTTGTAGAGTCTGCTAAACCAGTTTATACTTGGAATCACAGGACAGCTGGGTTCTGTTAACTAAATACATGAGACCTGACCGTTGATGAATGTATAGTGTGGTGGCTTTATAACTGGCTGCATATTGGGGCTTTTTCAAAGAATGCATGTCTGGGTCCTATCACAAGAAATTCTGACAATTGATTTGGGGTTCTGTCCTATAACACAAACAGTTTCTGGGGTGATTCTGAAGTTCTATGACTGGTTTAGAGCCTGGCGCGTTAGAGGACAAGTAACTGGGAAAACAAGTTCTACCCCTGGCTCTGCAAATAAAGTCATCCCTCCTTTTTAGAAGATACATAGCTAAAGAGTAAACAAGGCAAATTTTAACAGGTTTTGGCAACATCGGTTTTACATATATTTTAGATTAAAAGGTAAAAGTAAATACTAGTACTTTGCTGATAGGTTGTATCTAGACTTGTATTTTATATACATTACTTGGAATTTTAACAATGTGTAGGTTATTCACTATGAAATTCTTAACTTTAGGACTGAAAAGCATGTCACATAGGCCAAATTCATTCAGCAAAACTTCTGTTGGCACAGTGAATAATATTAACTACCAGGTTGTATGCTTAAATGCTTTATTTTGTTGAATTCTATTCCTATTATGTAGATCCAGAAATTGGCTTAGAGTTTTAACTTGCCCATTGTCCTAGAGCTTGAAACCATAGCTGAGATTTAAACAGGTATACAAGATGAGAATCCATCTTTTGATATCCCATTAAAGTATTGAAAAGTTTTTGCTATAGAA