Transcript asmbl_45686

Sequence
Transcript Sequence for observation asmbl_45686 of TGE0049405:
GCCGCGGCGAGGAGGAGCTGGAGCGGGAGTGACACCGGCGAGACCCAGCGCGACCTGAGGCGGCTCTAGGTGACTCGGGCCAGTGCAGAGGGCCCCAGGCCGCAGGCAGGAGCAGCTGGGCCAATTCCCTGGCCGGGGAACGGAAGGGGATGGCGTCGGGCCTGGGCTCCCCGTCCCCCTGCTCAGCGGGCAGTGAGGAGGAGGATATGGACGCACTTCTGAACAACAGCCTGCCCCCACCCCATCCAGAAAATGAGGAAGACCCAGACGAGGATTTATCCGAAGCAGAGACTCCAAAGCTCAAGAAGAAGAAAAAGCCTAAGAAACCTCGAGACCCTAAAATCCCTAAGAGCAAGCGCCAAAAAAAGGAGCGTTTACTCTTATGCCGGCAGCTGGGGGACAGCTCTGGGGAGGGGCCAGAGTTTGTGGAGGAGGAGGAAGAGGTGGCTCTGCGCTCAGACAGTGAGGGCAGCGACTATACTCCTGGCAAGAAGAAGAAAAAGAAGCTCGGACCTAAGAAAGAGAAGAAGAGCAAATCCAAGCGGAAGGAGGAGGAGGAAGAGGAGGACGAGGATGATGACTCGAAGGAACCTAAGTCATCAGCCCAGCTTTTAGAAGACTGGGGTATGGAAGACATCGACCATGTGTTCTCAGAGGAGGATTATCGGACCCTCACCAACTACAAGGCCTTCAGCCAATTTGTTAGACCCCTGATTGCTGCTAAAAACCCCAAGATTGCTGTCTCCAAGATGATGATGGTCTTGGGTGCAAAGTGGAGGGAATTCAGTACCAACAACCCCTTCAAGGGCAGCTCCGGAGCATCAGTGGCAGCTGCGGCGGCGGCGGCTGTGGCTGTGGTTGAGAGCATGGTGACAGCTACTGAAGTCGCCCCTCCCCCTCCCCCTGTGGAGGTGCCGATCCGCAAGGCCAAGACCAAGGAGGGCAAAGGTCCCAATGCTCGGAGGAAGCCGAAAGGCAGCCCGCGAGTGCCTGACGCCAAGAAGCCCAAACCCAAGAAAGTAGCTCCTCTGAAGATCAAGCTGGGAGGGTTCGGCTCCAAGCGGAAGAGATCCTCGAGTGAGGACGACGATTTAGATGTAGAGTCTGACTTCGACGATGCCAGTATCAACAGCTATTCTGTTTCGGATGGTTCCACCAGCCGCAGTAGTCGGAGCCGTAAGAAACTCCGGACCGCTAAAAAGAAAAAGAAAGGCGAGGAGGAGGTGACTGCTGTGGATGGTTATGAGACAGACCACCAGGACTATTGCGAGGTGTGCCAGCAAGGCGGCGAGATCATCCTGTGTGATACCTGTCCCCGAGCCTACCATATGGTGTGCCTGGACCCAGACATGGAGAAGGCCCCGGAGGGCAAGTGGAGCTGTCCGCACTGTGAGAAGGAGGGGATCCAGTGGGAAGCTAAGGAGGACAATTCTGAGGGTGAGGAGATTCTGGAAGAAGTCGGGGGGGACCCAGAAGAGGAGGATGACCATCACATGGAATTCTGTCGCGTCTGCAAGGACGGCGGGGAGCTCCTGTGCTGTGACACATGCCCTTCTTCCTACCACATCCACTGCCTGAACCCCCCGCTGCCAGAGATCCCAAACGGCGAATGGCTCTGTCCCCGCTGTACTTGTCCAGCTCTTAAGGGCAAAGTGCAGAAGATCCTAATTTGGAAGTGGGGCCAGCCACCGTCTCCCACACCAGTGCCTCGGCCTCCAGATGCTGACCCTAATACCCCGTCGCCCAAGCCCTTGGAGGGGCGGCCAGAGAGGCAGTTCTTTGTGAAATGGCAAGGCATGTCTTACTGGCACTGCTCCTGGGTGTCAGAACTGCAGTTGGAGCTGCACTGTCAGGTGATGTTCAGAAACTACCAGCGGAAGAATGATATGGACGAGCCGCCTTCTGGGGACTTTGGTGGAGATGAAGAGAAGAGCCGGAAGCGAAAGAACAAGGACCCTAAGTTTGCAGAGATGGAAGAGCGCTTCTACCGCTATGGAATAAAACCGGAGTGGATGATGATCCACCGCATCCTCAACCACAGTGTGGACAAGAAGGGCCACGTTCACTATTTAATCAAGTGGCGAGACCTGCCCTATGACCAGGCGTCCTGGGAGAGCGAGGACGTGGAGATTCAGGACTACGACCTGTTCAAGCAGAGCTACTGGAACCACAGGGAGTTAATGAGGGGTGAAGAAGGACGACCCGGCAAGAAGCTTAAGAAGGTGAAGCTACGGAAACTGGAAAGGCCTCCGGAGACCCCAACTGTTGATCCCACCGTGAAGTATGAGCGACAGCCGGAGTATCTGGATGCGACGGGTGGAACCCTGCATCCCTACCAAATGGAAGGCTTAAACTGGCTCCGCTTCTCCTGGGCTCAGGGAACCGATACTATCTTGGCTGATGAGATGGGCCTTGGGAAAACTGTGCAGACAGCAGTCTTCCTCTACTCCCTCTATAAGGAGGGTCACTCCAAAGGCCCCTTCTTAGTGAGCGCTCCTCTGTCCACCATCATCAACTGGGAGAGAGAGTTTGAGATGTGGGCTCCTGATATGTATGTGGTAACCTATGTGGGTGACAAGGACAGCCGTGCCATCATCCGGGAAAATGAGTTCTCCTTTGAAGACAATGCCATTCGTGGTGGCAAGAAGGCCTCGAGGATGAAGAAAGAAGCATCGGTGAAATTCCATGTTCTGCTGACATCCTATGAGTTGATCACCATTGATATGGCCATCTTGGGTTCTATTGACTGGGCCTGCCTCATTGTGGATGAAGCCCATCGGCTGAAGAACAACCAGTCTAAGTTCTTTCGAGTTTTGAATGGTTACTCACTCCAGCACAAGCTGTTGCTAACTGGAACTCCGTTACAGAACAATCTAGAGGAACTGTTTCATCTGCTCAACTTTCTCACCCCTGAGAGGTTCCACAACTTAGAAGGCTTCTTGGAGGAGTTTGCAGACATTGCCAAAGAGGACCAGATTAAAAAACTCCACGACATGCTGGGGCCTCATATGTTGCGGCGGCTCAAAGCTGACGTCTTCAAGAATATGCCATCCAAGACAGAGCTGATTGTGCGCGTGGAGTTGAGTCCTATGCAGAAGAAGTACTACAAGTATATTCTCACGCGGAATTTCGAAGCACTTAATGCTCGAGGTGGTGGCAACCAGGTTTCTCTGCTGAACGTGGTGATGGATCTTAAGAAATGCTGCAACCACCCTTATCTCTTCCCTGTGGCAGCAATGGAAGCCCCTAAGATGCCTAATGGTATGTATGATGGCAGTGCCCTAATCAGAGCATCTGGGAAGTTGTTGCTGCTGCAGAAGATGCTTAAGAACCTGAAAGAGGGAGGGCATCGTGTGCTCATCTTCTCCCAGATGACCAAGATGTTGGACTTGCTAGAGGATTTTTTAGAACATGAAGGTTATAAATATGAACGTATTGATGGTGGAATCACTGGGAACATGCGTCAGGAGGCCATTGATCGCTTCAATGCACCGGGTGCTCAACAGTTCTGCTTCTTGCTTTCCACTCGAGCTGGGGGCCTTGGGATCAATCTGGCCACTGCGGACACAGTTATTATATATGACTCTGACTGGAACCCCCATAATGACATCCAGGCCTTTAGCAGAGCCCACCGTATTGGGCAAAATAAGAAGGTGATGATCTACCGGTTTGTGACCCGTGCATCAGTGGAGGAGCGCATCACGCAGGTGGCAAAGAAGAAGATGATGCTGACACATTTAGTGGTACGGCCTGGCCTGGGCTCCAAGACAGGCTCAATGTCTAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAGCTATTCAAGGATGAAGCCACGGATGGAGGAGGAGACAACAAGGAGGGAGAAGACAGCAGTGTTATCCACTATGACGATAAGGCCATTGAACGACTGCTGGATCGAAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCTCAGTATGTGGTACGGGAAGAAGAGATGGGGGAGGAAGAGGAGGTAGAACGGGAAATCATAAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCGAAATCTGGGCAAAGGAAAAAGAATCCGTAAACAGGTCAACTACAATGATGGCTCACAGGAGGACCGAGGTGTGTGTGGCCGGCCCCGCCCCCCACCCACGGGCCGTTCCACTAGAGCAGTGGGCCCCGCTCATCTGCCCTCTCTCCCTCCAGATTGGCAGGACGACCAGTCCGACAACCAGTCCGATTACTCAGTGGCCTCAGAGGAAGGTGATGAAGACTTTGACGAACGGTCAGAAGCTCCCCGCAGGCCCAGTCGCAAGGGCCTGCGGAATGATAAAGATAAGCCATTACCTCCTCTGTTGGCCCGTGTTGGTGGGAATATTGAAGTACTTGGTTTTAATGCTCGTCAGCGAAAAGCATTTCTTAATGCAATTATGCGATATGGCATGCCACCTCAGGATGCTTTTACCACTCAGTGGCTTGTGAGAGATCTTCGAGGCAAGTCAGAGAAAGAATTTAAGGCTTATGTGTCACTCTTCATGCGACATTTGTGTGAGCCTGGGGCAGATGGGGCTGAGACCTTTGCTGATGGCGTCCCACGAGAAGGCCTGTCTCGTCAACATGTTCTCACTAGGATCGGTGTCATGTCTCTGATTCGAAAGAAGGTTCAGGAGTTTGAACATGTTAATGGACGCTGGAGCATGCCCGAACTGGCTGAAGTAGAGGAAAACAAAAAAATGTCTCAGCCAGGTTCACCTTCTCCAAAGACTCCTACACCTTCCACACCAGGGGACACACAACCCAATACTCCTGCGCCTGTGCCACCTGCTGAGGATGGGATAAAAATAGAGGAAAATAGCCTTAAAGAAGAAGAGAGCACAGAAGGAGAGAAGGAAGTTAAATCTACAGCCCCTGAGGCGACTGTGGAGTGTGCACAGCCCCCTGCCCCTGCCCCTGCCACTGCCCCTGCCACTGCCACTGCCCCTGAGGATGACAAGGCTCCTGCTGAGCCTCCTGAGGGGGAGGAAAAAGTGGAAAAGGCAGAGGTGAAGGAGAGAACAGAGGAGCCTATGGAGACAGAGGCCAAAGGTACTACTGAGGTGGAGAAAGTGGAGGAGAAGTCTGCGGTAGACCTGACCCCGATCGTGGTGGAAGACAAAGAAGAGAAGAAGGAGGAGGAGGAGAAAAAGGACGTGATGCTTCAGAATGGAGAAACTCCCAAGGATCTTAGTGATGAGAAGCAGAAGAAAAACAGCAAACAGCGTTTCATGTTCAACATTGCAGATGGTGGTTTTACTGAGTTGCACTCACTGTGGCAGAATGAAGAGCGGGCAGCCACAGTCACTAAGAAGACTTACGAGATCTGGCACCGTCGCCATGATTACTGGCTGCTGGCTGGCATTATAAACCACGGCTATGCCCGGTGGCAGGACATCCAGAATGACCCACGGTATGCCATCCTCAATGAGCCTTTCAAGGGTGAAATGAATCGTGGCAATTTTCTAGAGATCAAGAATAAATTTTTAGCTCGAAGATTCAAGCTCTTAGAACAAGCCCTGGTGATCGAGGAGCAGCTTCGCAGGGCAGCTTACCTGAACATGTCCGAGGACCCCTCTCACCCGTCTATGGCCCTTAACACCCGCTTCGCTGAGGTGGAGTGTTTGGCAGAAAGTCACCAGCACCTGTCCAAGGAGTCGATGGCAGGGAATAAGCCGGCCAATGCAGTCCTACACAAAGTCCTGAAACAGCTGGAGGAACTGTTGAGTGACATGAAAGCTGATGTGACGCGGCTCCCAGCCACCATTGCCCGCATCCCCCCAGTCGCTGTGAGGTTACAGATGTCAGAGCGGAACATTCTCAGCCGCCTGGCAAACAGGGCGCCAGAACCTCCCCCACAGCAGGTAGCCCAGCAGCAGTGAAAGACCCAGAGTGATATCCACCTCCACCACTCAGCAGTGACCTTCCTCACTTTCTCTTGTCCCGGCTGCCCCTGGGGGCCAGAGAGACCCTTGCCTTCCTTCTGCCCATCTTCTGAGTTGTAAAGGAACAGCCCTGCGCAGTGGGGCAGGGAGGGAGGGAGAAGCAATGGTGCCCTTCCTGCTGGAGAGACAAGCAGCAGTAGCGCAGCGCCCGCCCGCCATGTGCAGGAGCTGGCGGGCTGGCTGCCTTCTGGACCCTGGCTTCTCCCCACCGTGCGCCTGTTACAAACTGTTGTGGATTCTGCCAGGCTCGAAGAAAATGATCTGAATTTCTTCCTCTTTTTGGTTTTATTTTGTTGGTTTACTTTGTGTTTTCTCCTTTTTGGGGGGTATTCAGAGTGGGCCGGGCCCCTGGGCGAGACACAGCTACCTCTGTTGGCATCTTTTTAATACCAGGAACCCAGCGGCTCCAGCCACTGAGCAGCTAAATAAAGTTGG