Transcript asmbl_45684

Sequence
Transcript Sequence for observation asmbl_45684 of TGE0049404:
GCCGCGGCGAGGAGGAGCTGGAGCGGGAGTGACACCGGCGAGACCCAGCGCGACCTGAGGCGGCTCTAGGTGACTCGGGCCAGTGCAGAGGGCCCCAGGCCGCAGGCAGGAGCAGCTGGGCCAATTCCCTGGCCGGGGAACGGAAGGGGATGGCGTCGGGCCTGGGCTCCCCGTCCCCCTGCTCAGCGGGCAGTGAGGAGGAGGATATGGACGCACTTCTGAACAACAGCCTGCCCCCACCCCATCCAGAAAATGAGGAAGACCCAGACGAGGATTTATCCGAAGCAGAGACTCCAAAGCTCAAGAAGAAGAAAAAGCCTAAGAAACCTCGAGACCCTAAAATCCCTAAGAGCAAGCGCCAAAAAAAGGAGCGTTTACTCTTATGCCGGCAGCTGGGGGACAGCTCTGGGGAGGGGCCAGAGTTTGTGGAGGAGGAGGAAGAGGTGGCTCTGCGCTCAGACAGTGAGGGCAGCGACTATACTCCTGGCAAGAAGAAGAAAAAGAAGCTCGGACCTAAGAAAGAGAAGAAGAGCAAATCCAAGCGGAAGGAGGAGGAGGAAGAGGAGGACGAGGATGATGACTCGAAGGAACCTAAGTCATCAGCCCAGCTTTTAGAAGACTGGGGTATGGAAGACATCGACCATGTGTTCTCAGAGGAGGATTATCGGACCCTCACCAACTACAAGGCCTTCAGCCAATTTGTTAGACCCCTGATTGCTGCTAAAAACCCCAAGATTGCTGTCTCCAAGATGATGATGGTCTTGGGTGCAAAGTGGAGGGAATTCAGTACCAACAACCCCTTCAAGGGCAGCTCCGGAGCATCAGTGGCAGCTGCGGCGGCGGCGGCTGTGGCTGTGGTTGAGAGCATGGTGACAGCTACTGAAGTCGCCCCTCCCCCTCCCCCTGTGGAGGTGCCGATCCGCAAGGCCAAGACCAAGGAGGGCAAAGGTCCCAATGCTCGGAGGAAGCCGAAAGGCAGCCCGCGAGTGCCTGACGCCAAGAAGCCCAAACCCAAGAAAGTAGCTCCTCTGAAGATCAAGCTGGGAGGGTTCGGCTCCAAGCGGAAGAGATCCTCGAGTGAGGACGACGATTTAGATGTAGAGTCTGACTTCGACGATGCCAGTATCAACAGCTATTCTGTTTCGGATGGTTCCACCAGCCGCAGTAGTCGGAGCCGTAAGAAACTCCGGACCGCTAAAAAGAAAAAGAAAGACCACCAGGACTATTGCGAGGTGTGCCAGCAAGGCGGCGAGATCATCCTGTGTGATACCTGTCCCCGAGCCTACCATATGGTGTGCCTGGACCCAGACATGGAGAAGGCCCCGGAGGGCAAGTGGAGCTGTCCGCACTGTGAGAAGGAGGGGATCCAGTGGGAAGCTAAGGAGGACAATTCTGAGGGTGAGGAGATTCTGGAAGAAGTCGGGGGGGACCCAGAAGAGGAGGATGACCATCACATGGAATTCTGTCGCGTCTGCAAGGACGGCGGGGAGCTCCTGTGCTGTGACACATGCCCTTCTTCCTACCACATCCACTGCCTGAACCCCCCGCTGCCAGAGATCCCAAACGGCGAATGGCTCTGTCCCCGCTGTACTTGTCCAGCTCTTAAGGGCAAAGTGCAGAAGATCCTAATTTGGAAGTGGGGCCAGCCACCGTCTCCCACACCAGTGCCTCGGCCTCCAGATGCTGACCCTAATACCCCGTCGCCCAAGCCCTTGGAGGGGCGGCCAGAGAGGCAGTTCTTTGTGAAATGGCAAGGCATGTCTTACTGGCACTGCTCCTGGGTGTCAGAACTGCAGTTGGAGCTGCACTGTCAGGTGATGTTCAGAAACTACCAGCGGAAGAATGATATGGACGAGCCGCCTTCTGGGGACTTTGGTGGAGATGAAGAGAAGAGCCGGAAGCGAAAGAACAAGGACCCTAAGTTTGCAGAGATGGAAGAGCGCTTCTACCGCTATGGAATAAAACCGGAGTGGATGATGATCCACCGCATCCTCAACCACAGTGTGGACAAGAAGGGCCACGTTCACTATTTAATCAAGTGGCGAGACCTGCCCTATGACCAGGCGTCCTGGGAGAGCGAGGACGTGGAGATTCAGGACTACGACCTGTTCAAGCAGAGCTACTGGAACCACAGGGAGTTAATGAGGGGTGAAGAAGGACGACCCGGCAAGAAGCTTAAGAAGGTGAAGCTACGGAAACTGGAAAGGCCTCCGGAGACCCCAACTGTTGATCCCACCGTGAAGTATGAGCGACAGCCGGAGTATCTGGATGCGACGGGTGGAACCCTGCATCCCTACCAAATGGAAGGCTTAAACTGGCTCCGCTTCTCCTGGGCTCAGGGAACCGATACTATCTTGGCTGATGAGATGGGCCTTGGGAAAACTGTGCAGACAGCAGTCTTCCTCTACTCCCTCTATAAGGAGGGTCACTCCAAAGGCCCCTTCTTAGTGAGCGCTCCTCTGTCCACCATCATCAACTGGGAGAGAGAGTTTGAGATGTGGGCTCCTGATATGTATGTGGTAACCTATGTGGGTGACAAGGACAGCCGTGCCATCATCCGGGAAAATGAGTTCTCCTTTGAAGACAATGCCATTCGTGGTGGCAAGAAGGCCTCGAGGATGAAGAAAGAAGCATCGGTGAAATTCCATGTTCTGCTGACATCCTATGAGTTGATCACCATTGATATGGCCATCTTGGGTTCTATTGACTGGGCCTGCCTCATTGTGGATGAAGCCCATCGGCTGAAGAACAACCAGTCTAAGTTCTTTCGAGTTTTGAATGGTTACTCACTCCAGCACAAGCTGTTGCTAACTGGAACTCCGTTACAGAACAATCTAGAGGAACTGTTTCATCTGCTCAACTTTCTCACCCCTGAGAGGTTCCACAACTTAGAAGGCTTCTTGGAGGAGTTTGCAGACATTGCCAAAGAGGACCAGATTAAAAAACTCCACGACATGCTGGGGCCTCATATGTTGCGGCGGCTCAAAGCTGACGTCTTCAAGAATATGCCATCCAAGACAGAGCTGATTGTGCGCGTGGAGTTGAGTCCTATGCAGAAGAAGTACTACAAGTATATTCTCACGCGGAATTTCGAAGCACTTAATGCTCGAGGTGGTGGCAACCAGGTTTCTCTGCTGAACGTGGTGATGGATCTTAAGAAATGCTGCAACCACCCTTATCTCTTCCCTGTGGCAGCAATGGAAGCCCCTAAGATGCCTAATGGTATGTATGATGGCAGTGCCCTAATCAGAGCATCTGGGAAGTTGTTGCTGCTGCAGAAGATGCTTAAGAACCTGAAAGAGGGAGGGCATCGTGTGCTCATCTTCTCCCAGATGACCAAGATGTTGGACTTGCTAGAGGATTTTTTAGAACATGAAGGTTATAAATATGAACGTATTGATGGTGGAATCACTGGGAACATGCGTCAGGAGGCCATTGATCGCTTCAATGCACCGGGTGCTCAACAGTTCTGCTTCTTGCTTTCCACTCGAGCTGGGGGCCTTGGGATCAATCTGGCCACTGCGGACACAGTTATTATATATGACTCTGACTGGAACCCCCATAATGACATCCAGGCCTTTAGCAGAGCCCACCGTATTGGGCAAAATAAGAAGGTGATGATCTACCGGTTTGTGACCCGTGCATCAGTGGAGGAGCGCATCACGCAGGTGGCAAAGAAGAAGATGATGCTGACACATTTAGTGGTACGGCCTGGCCTGGGCTCCAAGACAGGCTCAATGTCTAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAGCTATTCAAGGATGAAGCCACGGATGGAGGAGGAGACAACAAGGAGGGAGAAGACAGCAGTGTTATCCACTATGACGATAAGGCCATTGAACGACTGCTGGATCGAAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCTCAGTATGTGGTACGGGAAGAAGAGATGGGGGAGGAAGAGGAGGTAGAACGGGAAATCATAAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCGAAATCTGGGCAAAGGAAAAAGAATCCGTAAACAGGTCAACTACAATGATGGCTCACAGGAGGACCGAGATTGGCAGGACGACCAGTCCGACAACCAGTCCGATTACTCAGTGGCCTCAGAGGAAGGTGATGAAGACTTTGACGAACGGTCAGAAGCTCCCCGCAGGCCCAGTCGCAAGGGCCTGCGGAATGATAAAGATAAGCCATTACCTCCTCTGTTGGCCCGTGTTGGTGGGAATATTGAAGTACTTGGTTTTAATGCTCGTCAGCGAAAAGCATTTCTTAATGCAATTATGCGATATGGCATGCCACCTCAGGATGCTTTTACCACTCAGTGGCTTGTGAGAGATCTTCGAGGCAAGTCAGAGAAAGAATTTAAGGCTTATGTGTCACTCTTCATGCGACATTTGTGTGAGCCTGGGGCAGATGGGGCTGAGACCTTTGCTGATGGCGTCCCACGAGAAGGCCTGTCTCGTCAACATGTTCTCACTAGGATCGGTGTCATGTCTCTGATTCGAAAGAAGGTTCAGGAGTTTGAACATGTTAATGGACGCTGGAGCATGCCCGAACTGGCTGAAGTAGAGGAAAACAAAAAAATGTCTCAGCCAGGTTCACCTTCTCCAAAGACTCCTACACCTTCCACACCAGGGGACACACAACCCAATACTCCTGCGCCTGTGCCACCTGCTGAGGATGGGATAAAAATAGAGGAAAATAGCCTTAAAGAAGAAGAGAGCACAGAAGGAGAGAAGGAAGTTAAATCTACAGCCCCTGAGGCGACTGTGGAGTGTGCACAGCCCCCTGCCCCTGCCCCTGCCACTGCCCCTGCCACTGCCACTGCCCCTGAGGATGACAAGGCTCCTGCTGAGCCTCCTGAGGGGGAGGAAAAAGTGGAAAAGGCAGAGGTGAAGGAGAGAACAGAGGAGCCTATGGAGACAGAGGCCAAAGGTACTACTGAGGTGGAGAAAGTGGAGGAGAAGTCTGCGGTAGACCTGACCCCGATCGTGGTGGAAGACAAAGAAGAGAAGAAGGAGGAGGAGGAGAAAAAGGACGTGATGCTTCAGAATGGAGAAACTCCCAAGGATCTTAGTGATGAGAAGCAGAAGAAAAACAGCAAACAGCGTTTCATGTTCAACATTGCAGATGGTGGTTTTACTGAGTTGCACTCACTGTGGCAGAATGAAGAGCGGGCAGCCACAGTCACTAAGAAGACTTACGAGATCTGGCACCGTCGCCATGATTACTGGCTGCTGGCTGGCATTATAAACCACGGCTATGCCCGGTGGCAGGACATCCAGAATGACCCACGGTATGCCATCCTCAATGAGCCTTTCAAGGGTGAAATGAATCGTGGCAATTTTCTAGAGATCAAGAATAAATTTTTAGCTCGAAGATTCAAGCTCTTAGAACAAGCCCTGGTGATCGAGGAGCAGCTTCGCAGGGCAGCTTACCTGAACATGTCCGAGGACCCCTCTCACCCGTCTATGGCCCTTAACACCCGCTTCGCTGAGGTGGAGTGTTTGGCAGAAAGTCACCAGCACCTGTCCAAGGAGTCGATGGCAGGGAATAAGCCGGCCAATGCAGTCCTACACAAAGTCCTGAAACAGCTGGAGGAACTGTTGAGTGACATGAAAGCTGATGTGACGCGGCTCCCAGCCACCATTGCCCGCATCCCCCCAGTCGCTGTGAGGTTACAGATGTCAGAGCGGAACATTCTCAGCCGCCTGGCAAACAGGGCGCCAGAACCTCCCCCACAGCAGGTAGCCCAGCAGCAGTGAAAGACCCAGAGTGATATCCACCTCCACCACTCAGCAGTGACCTTCCTCACTTTCTCTTGTCCCGGCTGCCCCTGGGGGCCAGAGAGACCCTTGCCTTCCTTCTGCCCATCTTCTGAGTTGTAAAGGAACAGCCCTGCGCAGTGGGGCAGGGAGGGAGGGAGAAGCAATGGTGCCCTTCCTGCTGGAGAGACAAGCAGCAGTAGCGCAGCGCCCGCCCGCCATGTGCAGGAGCTGGCGGGCTGGCTGCCTTCTGGACCCTGGCTTCTCCCCACCGTGCGCCTGTTACAAACTGTTGTGGATTCTGCCAGGCTCGAAGAAAATGATCTGAATTTCTTCCTCTTTTTGGTTTTATTTTGTTGGTTTACTTTGTGTTTTCTCCTTTTTGGGGGGTATTCAGAGTGGGCCGGGCCCCTGGGCGAGACACAGCTACCTCTGTTGGCATCTTTTTAATACCAGGAACCCAGCGGCTCCAGCCACTGAGCAGCTAAATAAAGTTGG