Transcript asmbl_67107

Sequence
Transcript Sequence for observation asmbl_67107 of TGE0007193:
AGCTCAAGAGATGGCTGCCCAGTGTGTGACAAAGGTGGAGCTGAATATTTCCTGCGACAATCTTCTGGATAAAGACATAGGGTCCAAGTCGGACCCGTTATGCGTGTTATTTTTGAATACGAGCGGCCAGCAGTGGTATGAGGTTGAGCGCACAGAAAAGGTCAAGAATTGCTTGAATCCCACATTTTCCAAGACTTTCATTATTGATTACTACTTCGAAGTGGTTCAGAAATTGAAATTTGGGATTTATGACATCGACAACAAGACTATAGAGCTGGGCGATGATGACTTCTTAGGAGAATGTGAATGCACCCTTGGACAAATTGTTTCCAGTAAGAAGCTGACCCGACCCCTGGTGCTTAAGAATGGCAGACCTGCGGGGAAAGGCAGCATCACGATTTCGGCTGAAGAGATAAAGGATAACAGAGTCGTCTTGTTTGAAATGGAAGCCAGGAAACTGGATAATAAGGATCTCTTTGGGAAGTCAGATCCGTACCTGGAATTCCACAAGCAGACATCTGATGGCAACTGGCTCATGGTTCACCGGACAGAGGTTATTAAAAACAACTTGAATCCTGTTTGGAGGCCTTTTAAAATCTCCCTTAACTCCCTGTGCTATGGAGATATGGATAAGATTATCAAGGTAGAGTGCTATGACTACGATAACGATGGGTCACATGATCTCATTGGAACATTCCAAACCACCATGACGAAACTGAAAGAGGCCTCCAGGAGCTCGCCTGTTGAATTTGAATGCATAAATGAAAAGAAGAGACAGAAGAAGAAAAGCTACAAGAATTCCGGTGTCATCAGTGTGAAGCAGTGTGAGATTACAGTGGAATGCACATTCCTTGACTATATCATGGGAGGCTGTCAGCTGAATTTTACTGTGGGGGTGGACTTCACTGGCTCCAACGGTGACCCACGGTCTCCTGACTCCCTTCATTACATCAGCCCCAACGGCGTGAATGAGTACTTGACCGCCATCTGGTCTGTGGGGCTGGTCATTCAGGATTACGATGCTGATAAGATGTTTCCAGCCTTTGGGTTCGGAGCTCAGATTCCTCCTCAGTGGCAGGTGTCGCACGAATTCCCCATGAGCTTTAACCCGTCCAACCCCTACTGTAATGGAATCCAAGGCATTGTGGAGGCATATCGGGCCTGTCTTCCTCAGATAAAACTCTATGGACCAACAAATTTTTCTCCCATCATCAATCACGTGGCCAGGTTTGCTGCCGCAGCCACACAGCAGCAGACAGCTTCTCAATACTTCGTGCTGCTCATCATCACCGACGGTGTGATCACGGACCTGGACGAGACCAGACAGGCGATCGTCAGCGCCGCCAAGCTGCCCATGTCCATCATCATCGTTGGCGTCGGCGGCGCTGACTTCAGCGCCATGGAGTTTCTGGACGGTGACGGTGGGGGCCTGCGCTCCCCGTCAGGGGAGACTGCCATCAGGGACATCGTGCAGTTCGTGCCTTTCAGGCAGTTCCAGAATGCTCCCCGAGAAGCGCTGGCTCAGTGCGTCCTGGCGGAGGTCCCCCAGCAGGTGGTGGGCTACTTCAATACCTGCAAGCTCCTGCCCCCCAAGAACCGCACCGCCCAGTGAAAACGCTCCTGCGCCGCACTGCGGGCTGCCCGTTTCCCACGCTCCCCAGCATCCGTGACGGAAACCGAGTCCCCGTGGACTGCGTCTCCTTAAAGCATTCTTTTATACTTTTCTTGGAAGAAAGTGCTAACTTAACCTTTGTCCAATCAATTCAGTGATTGCTAGTGATTAGAGACTCGCACGAGGAAAGCCGCCTTTGCCATGGTGATTGTTTGCTCTCACAGGATGAAGATGCTGGTTGGAACATTCGTCAGTAGAGAGGATGAAGACTTGTTGGGGGTGGGGGAATTTCAGGCCGCTGTGCTTCGTCGGCTCGAGGCCACATGTGCTACAAGTCAGTGTCCGTCCCCGGTGACGGGCGCTTCTCAAAGCAGACGTGCTGAACCTGTCCCTGCAGTTGCTGAGTGCCTGACCCTTGCCCAAGTCTCGCTGCGGCTTAGCCACAGCACAGCTCGCCCCAGCAGCACCCCAAGACTCTCCGAAGAGCGCAGACGAGGACAGGCACCCTTGCACTTCTCAAAAGGAAGAGGAGCCTCAGGAACGTGCGCGGCTGTTCCCGTGTGCCTTTCCAGGACCCGTGTCTGCACGGAGGGCAGGCCGACCGGGCTCAGCGTCAGTAGCGTTTTTTAATTGGAGTTTGTCAGAATGGTTACGACTGCCTAGTCCAGGAAAGCTACGAGGACCAGACGTGTAGAGAAAACTGAGAATCCCTTCCCTTTTAGCCAATGAAGACTTTACTTACTAAGAAAGGACAATTTTTATCCTTGCTGAGGTCCTATACATTGATTAGTACATTTCTTCACATTCGTGTAGACATTTTTTCCTGTTTTCTTTAGTTACTCTTTTAGTCTGGTTTTTAAACTCATGATAGTGGTTGTCTATTAATCAAAATCATATTTTGCATTTTAATAATGTGCTATTTCCTAAGCCCAGAATGTACTGTATTAAGCCTAAAACCTGTTGCAACTTAAAAAAAATAGCCAACATGCTCTAAGAGCAGAATTCCCCCTTTCAGAATACATTACTCAGCAAACGCTGTCAGAACAGTCAGTAATGTTTTATTGAGGACCTGTGTGCCAGGTACCACGCATACCCACATGTTGGCCAATTATCTTGGATAATTTGACATGAAAATTTGCATGTTTGTCATGTACCCTCAAGGGGACACGCCCAGTGCCATGCCAGCATGCCTTTCGCTCTTTCTGAAACTGCGCCACGGCTCTGGTCTCTTGTTCTCTGAGATGTCTGAAGGACGCGTGAGCCTCGGCCAGGCTCCGTCTGAGAGGGGAGCTGCCTGCTGTCGTGGTCACCCAGCCAGGCGGGCAGTCACCGCCTTCCCGCTCAGTCCGCTGGTCCCTGGCTGCGCGCTGCTGACCTGAAGGCGCCTGACTGGCCGTCTGTACTCCAGGGAGCGGCTCCTTGGCCGGCAAGCCCTTCTGCTGTCAGTTAGGGGAGGGGACTGACGTCCCGCCCAAAGGCTGGGGCCTGCGCTGTCTCAAGTCCTGGTTTGGGTCCTGCGCCTGGGAACAGCACGTGCGTGCCGCTGTTTCAGAAGTTCCTTCTGCAAACACGCGAAGCCTTCTAGAAAAGGTTCCCACACGTTCCCCACGCCTGGTGAGACGCTCAGGAGCAGAGCCCTCGGTTGGGGTCGGCCGGGCTGCACGCCACTCCCCGGGCCTCCTCGTCACCCCCTCACCGCTCCTCATGCTCCTCACAGCTGTGGCCTCTGCAGGGCACTGGGGACCGCTGTCGTGGGTGCTCACTGAGGTCACTGGCCAAGCACGGTACTCTGTCACCACCATCAAATTGATTTGGTCTTCATAGTTACATCATCTGTTTTAACCAAAATTGTTCCCTTTTAAAATTAGTTTTTTGTTATTCATTCTTGATCGGGTTCATCAGTAGATGCTGTTATTCATAAGAACTGTGATTCCAGCAAATTAAGGTAATTGATACCTTTTTGCAGTTTTGAATAAACGCATTTACAATTTCTAAATAATATAAAATTCATACGATTTCGACGTTTCACCTCATTGCCTGCTGATTTAATATTGTTTTATATTAAAAGTCATTTTCCCTGTTGTGCCACCGTTCATTCAAGTGCCATTAGTTCTTAAAATGCCTTTACAGAAAACACAAGCAGTTTGCCTTCCACACCTCCCAGCATGAGACACACTGCGAACGCGTTTGGCCTGACAGCGCCCCGGGCAGAGGCACGGCTTCTCCCCTGCCCGCTGCTAGACGGTGCGCCAGCTAGCACGGCCGCGCCATCGAGCGCTTGGGACCGAAATGGTTACGGTCCCAGGTTTAGTCTCAGGGTGACACTTGTGCCCTGTGCCGTTTCTCCGCAGACTTCCCAGAGCAGATTCAGGGCCCAGTGCTGCTGACGCTTCATTCCACGCGCTGTGCCCTTTTCATTTTGTAAACTTCCCGGAAAGCCACCTTCAGTAGACGCCTCCTAATCTACGTGTGCCATCGACGGTCATGGAAGTGACACATAAGCGAGAAGTTTGGCGTTAATTGCGAGAAACTATTTTGTGCTTTTTGGATGTCATACTCGACAGTGTACAAGTTACAAATACATGAATTGATGTTGAATATATCTCCCATTTGAGATCCCTTTGGATAAAGTTATTTCTTGATGTGACACACAAGAGTGCCTTGTTCTCATTTTTTTCTCTGGTATCAAAACCAGTAGAAAAGTTAGAAATAAAGTGAATGTAGAAATAAAGCAAATGTAGTATTTTATTCTGTACTCTATATGTTACTGAATTAAAGGGTTTAGAAGTTT