Transcript asmbl_45354

Sequence
Transcript Sequence for observation asmbl_45354 of TGE0034453:
CGGCGCGTGCGCAGTGGTGCCGGTGGCCCTTCCGGTGCGCCGGACGCAGCTAGGCTGTACAGACGCGGGCACGCACACCAGCACGCACGCCCTCCTCTCGTGCGGCCGCGGTCGTTCCCGCGTCCACCAGCAGCGCTGTCGCTTCGGCAGAAATGCTGCGGGCCTGTCAGTTATCCGGCGTGACCGTCGCGGCCCAGAGTTGTCTGTGTGGGAAGTTCGTCCTCCGTCCACTACGACCATGCCGTAGATACTCCACTTCAAGCAGTTCTGGGTTGACTGCTGGTAAGATTGCTGGAGCTGGCCTTTTGTTCGTTGGTGGAGGGATTGGTGGCACTATCCTGTATGCCAAATGGGATTCCCATTTCCGGGAAAGTGTAGAGAAAACCATCCCTTACTCAGACAAACTCTTTGGGATGGTTCTTGGTTCTGCGCCTTATACTGTTCCATTACCAAAGAAACCGGTTCAGTCTGGTCCACTAAAAATCTCCAGTGTATCAGAGGTGATGAAAGACTCCAAACTGCCTGTGGCACAGAGCCAGAAAACGAAGGGAGACACTCCAGCTTCAGCAGCAGGTGATACACTTTCGGTCCCGGCCCCTGCAGTTCAGCATGAGGACACTATAAAAACCGAATGTCCCAACACTAATGAAGGAAAATCTACGTCTGAAACCACAGCTCTAGCCAAGAGTTTAGAAGATGCTCTGAACCGGACTTCGTCTGTCACTCTGCAGACTATTACAGCCCAGAATGCTGCAGTTCAGGCTGTCAAGGCACACTCCAACATACTGAAAACAGCCATGGACAATTCTGAGATTGCAGGTGAGAAGAAGTCGGCCCAGTGGCGAACAGTGGAGGGTGCATTGAAGGAGCGAAGAAAGGCAGTTGATGAAGCTGCCGATGCCCTGCTCAAAGCAAAAGAAGAGTTAGAGAAGATGAAAACTATAATTGAAGATGCAAAGAAAAGAGAGATTGCTGGAGCCACCCCTCATATAACTGCTGCAGAGGGGAGACTTCACAACATGATAGTTGATCTGGATAACGTCGTCAAAAAGGTCCAGGCTGCTCAGTCAGAGGCAAAGGTGGTATCTCAGTATCATGAACTTGTGGTCCAAGCAAGAGATGACTTTAGAAAAGAGCTGGACAGTATCACTCCAGACATCACTCCTGGATGGAAAGGGATGAGTAAGTACAACTGATTCTGGCAAACTCTCTACTGATGACCTGAACTCACTCATTGCTCATGCCCATCGTCGCATTGATCAGCTCAACAGAGAGCTAGCACAACAGAAAGCCACAGAGAAGCAGCACATTGAGCTAGCCTTGGAAAAGCACAAGCTAGAAGAAAAGCGGACCTTTGACTCTGCAGTGGCAAAAGCATTGGAGCACCACAGAAGTGAAATTCAGGCTGAGCAGGACAGAAAGGTAGAAGAAGTCAGAGATGCCATGGAGAATGAAATGCGGACCCAACTTCGACGGCAGGCAGCTGCCCACACTGATCATTTACGAGATGTCCTCAAGGTGCAGGAACAGGAACTGAAGTATGAATTTGAACAGGGCCTGTCTGAGAAACTGTCTGAGCAAGAATTAGAGTTTCGTCGTCGCAGTCAAGAACAAATGGACAGCTTTACTCTGGACATAAATACTGCCTATGCCAGGTTGAGAGGGATTGAGCAGGCTGTTCAGAGTCATGCAGTTGCTGAAGAAGAAGCCAGAAAAGCCCACCAGCTCTGGCTTTCAGTGGAGGCATTAAAGTACAGCATGAAGACCTCATCTGCAGAAATGCCTACCATCCCATTGGGGAGTGCAGTTGAGGCCATCAGAGTCAACTGTTCTGATAATGAATTTACCCAGGCTTTAACTGCAGCCATTCCTCCAGAGTCCCTGACCCGGGGGGTATACAGTGAAGAGACCCTAAGAGCCCGTTTCTATGCTGTTCAAAAACTAGCCCGAAGGGTAGCGATGATTGACGAAACCAGAAATAGCCTGTACCAATACTTCCTTTCCTACTTACAGTCCCTACTCCTGTTCCCGCCTAAGCAACTGAAGCCCCCGGCGGAGCTCTACCCTGAAGATATAAATACATTTAAATTGCTCTCATATGCCTCCTATTGTATTGAGCATGGTGACCTGGAGCTGGCAGCAAAGTTTGTCAATCAGCTCAAAGGGGAGTCCAGAAGAGTGGCACAGGACTGGCTGAAGGAGGCCCGAATGACCCTAGAAACTAAGCAGATAGTGGAGATCCTGACTGCATACGCCAGCGCCGTAGGAATAGGAACCACTCAAGTGCAGCAAGAGTAAGGCCTAGGAAGAGTTGTGTAATGTCATATTTCATATCAAAGAAAATCAGCATTGGTATCTGCAGGGTTTGCAACAAGGGTCCCAGAATTGTCCAGAAGTGAGCAGGTTCCAAGTCCTGTGTGAGATGTTAACACCTGTTGCATTTACCGTCCTTACACTGCTATCATGCCAATGAACTCCAGGAGGCTTTATTTGCAACTTGTGTAACACTTCCTGTTTTTTAGGTTTTACTGATCAGGCTTGTGAGCCACTCAAAATAATGTTTGTGATCCCTACTATTGATTCTGCCCTTGGAGCAAACTGAATAAAGCAACACAATGAAAACTGA