Transcript asmbl_4497

Sequence
Transcript Sequence for observation asmbl_4497 of TGE0049320:
CCTACCAACGCCGAGGTGCTCAAGGTCCTAGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTCCTGCCCATGCTGCAGACCGTGGCCAAGAACAAGGACCAGGGAACCTACGAGGATTATGTTGAAGGCCTTCGTGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGTCATGTCCTAGTCACACTGGGCGAGAAGATGACAGAGGAAGAAGTAGAGATGCTAGTGGCGGGGCATGAGGACAGCAATGGTTGCATCAACTATGAAGCATTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGAGCTTGTCCGGATGGTGCTGAATGGCTGAGGACATTCTGTATCCCGAGTCTGTTCCTTGCCCAGTGTGATTTCTGTGTGGCTCCAGAGGCTCCCCTGTCACAGCACCTTGCCCATTTGGTTTCTTTTGGATGATGTTTGCCTTCACCAAATAAAATTTGCTCTCTTTGCCCTC