Transcript asmbl_6648

Sequence
Transcript Sequence for observation asmbl_6648 of TGE0007136:
GGAAGCCCGCGGTGTCCGGTCCCAGCCTTCTCTGGGAGCGGGCGGTGGGCAACGCCGGGGTGACCCGCGCCCCTCGTTCTTGAGCCCGCGCGCTCTGAGAGGGTGCTCGGACAGATTGAAGCCATGGCTATTCTTTTTGCCGTCGTTGCCAGGGGAACCACCATCCTTGCCAAACACGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTCTGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACACAGCAACTATTTGTTTCATTACATCTGCCAAGACAGGATCGTGTACCTTTGTATCACTGATGATGATTTTGAACGTTCCAGAGCCTTTAATTTTCTGAATGAGATCAAGAAGAGATTCCAGACCACGTATGGTTCAAGGGCACAGACAGCACTCCCATATGCCATGAACAGTGAGTTCTCAAGTGTCTTGGCCGCACAGCTGAAGCATCATTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAACGAGGAGAAAGATTGGAATTATTGATAGATAAAACAGAAAATCTCGTGGATTCGTCTGTCACCTTCAAAACAACCAGCAGAAACCTTGCCCGAGCCATGTGCATGAAGAATCTCAAGCTCACCATCATCATCATCGTCGTATCAATCGTGTTCATCTACATCATCGTGTCACCTCTGTGTGGTGGATTTACATGGCCCCGCTGTGTGTAAAAATAGAAAAGACAAAGTTATTCACCGGACGACACGAGAGAACAAGGAGTTAAAAGGCCGAATGATCTAAACCTTTCACTACTGACAGATGGCGTCTGCCAGTCTCTTCAGCCCTCTCTTTCTCTTTCTGTTTTTAATCCTGTTCTATGCATCCAGATTTATCTTTGTCCTCTCAGTCAGTTTATTCCAGTGTACTTCAAAATGAACCATTTATTGCAGCAGTAGCCTTAAAAAGGCTTTTGTCCGTTCCTTTGGTTTGTTCACTAGTATTATAGACTCAGAGAAACGTTTTCGTCGGTGATTGCACAAAGCCATCGCCAAGGTGGAAAACACCAGTCTTGTAAACTGCCTGCTAAAACTGTAGCTGAACATTGTACGTGCACAGAAAAGTATTCGAGAGACACGTATTGCTACCATCTCATGTTTATGTCTTTTGGTATTGAGGAGTTTTAGATGCTCGAAAACAATACGAATGGAGAATTACTGTTATTTGGGGAATTGTAATTCAATTGTTGGTGCTGCCTGCTTCTAGCAGCCCAAGCAGATAAAGTATTAGACATTCTGTCTTGGTCAGAGGGAGAATATTTTTAGAAGCACGTGGAATTATGTTCGACTTCCTAGTACTCACTTTCAGGAAGAAAGATTTGACCATTTGCAAACCTCACAGAGCTCAGTAGCTTCTGTTTCCCCGTTGCAGTTGATTTGAGAAGATAATGGTTTAAATATGGCCGAAGGTTATGGTTTTCCACATATTTCTTTGGTCCTCAGTTGATTTTTAGAGCCATTCTATAGTTAATAGAATAGACAGTGGAGGGGGTGGGGAGGCACCACAGAGGACACGCTAACGTTTTAGCTCTGTGAATGGAGGCAGCGTGGGAAGGTTTTTCCTTTCTGGGAAAAGCCCAAACAGAACATGGTCAGCTCCAGGGTTTGGGTCTGGCTGCTGTCGAATAATAATAGTCTGAGCATCCTTTGTGGTTCAGTAAGTTCTTTAATCTGCCTACTTTTGAAGAATTCTTTCGTGAAACGAGAGTAGGCACGACGATGTCTAGAAACAACGCAAGACAGTTCAGCATCCATTTAACTGCACTGTAGGAAAACTGCTGTGGATGCTTCGCTTCGGCGACTGTGACGTCTCTCTGCTGGTGTGTACTTTTGGTGTGTATCTGGAAGGACATTTACTGCTCTGGATCTAACTGCATTTATTGATCAATAAATGCCAGTAAGCAGAAATTCTATTATATTCGACTATTTTCCCAATAAAAGAACAAATCAGTCTGTAAAACCTAGCCACCTGTTTAGCCTAGTCACGTGCCTTGAATATATATGTGTCATATAACCTGGCTGATGCTACCTGTTCTTCCACGTAAACCTTTCGGTTCATTAATTGGACACGGATTTCAGGCCCACTGGAACGCTTTTCCTGGCGACCATGCATTCTACAAATGTTCTCTTTATCAACACTAATGCCTTTTAATTGCATCAGCATTTCCTACTGGAAAACACATTTGTTCCAGGAAAACATTTGCCATTCCTGAATAATAATTTCCAAATGTCTTTAATCCAAAGAAGAGGACTTAAAGTGGATTTCCCTTTCGTATACACGACTGAATAAAAATGATGTGCATGTCTTAGGGATAAATGACTTAACTGTCCCTCGATCTGTTTATGTATAAGAATGCTTTTTAAAGCACATATCTTGTTTTAAATGACGCACAAACTGAAGGCAT